Labshake search
Citations for Millipore Sigma :
9901 - 9950 of 10000+ citations for Recombinant Human ETS1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... the remaining chromatin was divided amongst separate tubes containing protein A dynabeads pre-incubated with either 2μl anti-H3K4me3 (Millipore 07-473), 10μl anti-H3K27me3 (CST 9733 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was diluted to 0.01 mg/mL concentration in 100 µL of 25 mM Tris/HCl buffer containing various concentrations of SAHS proteins or BSA (Sigma-Aldrich). 50 µL of each sample was stored at 4°C while the other 50 µL was dried using a Savant SPD131DDA SpeedVac (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... bead-bound samples were successively incubated with appropriate amount of primary antibodies against protein-of-interest (CTCF antibody: Millipore, 07-729) in 50µL of CUT&RUN antibody buffer for overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... determined by BCA assay were precleared for 1 hour with Protein G Sepharose 4 Fast Flow beads (GE17-0168-01, Millipore Sigma) at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins eluted by 100 mM imidazole were collected and then desalted with disposable PD 10 desalting columns (Sigma, GE17-0851-01) against stocking buffer (20 mM HEPES (pH 7.3) ...
-
bioRxiv - Biochemistry 2023Quote: Studies of SAMHD1-controled dynamic equilibria of dNTP concentrations (Fig. 5) were performed using a 10 mL stirred-cell pressurized protein concentrator (Amicon; EMD Millipore) assembled with a 10 kDa MWCO nitrocellulose membrane (Millipore) ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was incubated for 1h at 4 °C in the presence or absence of 20 or 100 µM FTY720 (Sigma-Aldrich) or fumonisin B1 (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels were then incubated overnight with primary antibodies against Yes-associated protein (YAP) (mouse monoclonal anti-YAP, 1:400, Sigma-Aldrich) at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: To generate emulsions, 1 mL of fluorinated oil (Novec 7500, ACOTA) and 2 mL of protein solution (β-lactoglobulin; >90%, Sigma, from bovine milk ...
-
bioRxiv - Biochemistry 2023Quote: Clicked and dissolved protein samples were diluted to 4 M urea with 50 mM ammonium bicarbonate (pH 8, AmBic, Sigma-Aldrich). The proteins were reduced with 4 mM DTT (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... anti-ZEB-1 (Zinc finger E-box-binding homeobox 1, Cat. #SAB3500514, from rabbit), and anti-Snail (Drosophila embryonic protein, Cat. #SAB2108482, from rabbit) were purchased from Sigma-Aldrich. Anti-EpCAM-PE (anti-epithelial cell adhesion molecule labeled with phycoerythrin ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant containing the phage suspensions were further filtered through low protein binding 0.22 µm pore size polyethersulfone (PES) membrane filters (Millex-GP, Millipore, Bedford, Massachusetts), diluted and plated as indicated in the previous paragraph to verify the uniformity of the plaques ...
-
bioRxiv - Microbiology 2023Quote: ... The upper part was used for protein detection using a specific monoclonal antibody against Cas9 (1:1000 dilution, #MAC133, Sigma-Aldrich) and Alexa555 secondary antibody for fluorescence detection (iBright ...
-
bioRxiv - Microbiology 2023Quote: ... and the flow-through containing cleaved protein was collected and concentrated to 2 mL by ultrafiltration (Amicon Ultra-15, EMD Millipore), then passed over a size exclusion column (HiLoad Superdex 200 PG ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein loading was determined using a monoclonal β-actin antibody directly conjugated to horseradish peroxidase (1:20,000) from Sigma-Aldrich (A3854). Quantitation of western blot band intensity was done using Image J software.
-
bioRxiv - Biochemistry 2023Quote: ... Protein was eluted with elution buffer until resin no longer appeared yellow and concentrated to 1 mL in a 3K protein concentrator (Millipore Sigma). Concentrated protein was purified by SEC as described above.
-
bioRxiv - Bioengineering 2023Quote: We verified the patterning and the pattern transfer to PA hydrogel using green fluorescent laminin (as described in Protein patterning glass coverslips) and a pan-cadherin primary antibody (Sigma, C3678). We diluted the pan-cadherin antibody 1:200 in PBS and incubated on the devices for 1 hour at room temperature ...
-
bioRxiv - Physiology 2024Quote: ... and proteins were detected by Western blot using monoclonal anti-Flag M2 antibody produced in mouse (1:5000 dilution; Sigma-Aldrich), rabbit anti-FKBP12 antibody (1:1000 dilution ...
-
bioRxiv - Genomics 2024Quote: ... The following primary antibodies are used for the first target protein at the dilutions indicated: NeuN (1:500, A60, Mouse, Millipore MAB5374), pTDP43 (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... Horseradish peroxidase conjugated secondary antibodies (table 2) were added for 1 h at room temperature and protein signal was then visualized using Immobilon Forte (Millipore, WBLUF0500) on ImageQuant LAS 4000 or Amersham ImageQuant 800 ...
-
bioRxiv - Neuroscience 2024Quote: ... Chromatin samples were pre-cleared with 10 µl of Magna-ChIP® protein-G magnetic beads (EMD Millipore, Cat: 16-662) pre-blocked with BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibodies and chromatin were mixed with 20 µl of Magna-ChIP® protein-G magnetic beads (EMD Millipore, Cat: 16-662) for 2 hours at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... of GST and His tagged proteins were subjected to buffer exchange using Amicon Ultra 0.5 ml 10 kDa cutoff columns (Millipore Sigma, UFC501024) with five sequential rounds of concentration performed by centrifugation at 14000 g and 4 °C for approximately 10 minutes and dilution with “EB base” (5x ...
-
bioRxiv - Biochemistry 2024Quote: Cells were harvested by centrifugation at 2000 x g for 15 minutes at RT and resuspended in Lysis Buffer (1X BugBuster® Protein Extraction Reagent (Merck-Millipore), 20 mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1 mM NaF) and proteins were eluted by incubating the beads in TEV buffer containing TEV protease (T4455, Sigma Aldrich) overnight in 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The samples were then blocked in 6% donkey serum and immunolabeled for protein gene product 9.5 (PGP9.5, 1:500, Millipore-Sigma, SAB4503057-100UG) as a pan-neuronal marker or rabbit-IgG (Abcam ...
-
bioRxiv - Biophysics 2024Quote: Sf9 cells used for insect derived proteins were maintained at 1 × 106 cells/mL in Sf-900 TM II SFM supplemented with penicillin/streptomycin (Sigma-Aldrich) and fungizone (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Clone TS2/16 antibody was left incubating overnight and after that the immuno-complex was captured by adding 50μl of protein A/G agarose (Merck Sigma, Burlington, MA) beads for 2 hours at 4°C (with rolling agitation) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pold1 D400A mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/uL Cas9 protein (Millipore Sigma), .6pmol/uL each crRNA (spacer sequence CCCGAGAGATGAGGTATGGG ...
-
bioRxiv - Cancer Biology 2024Quote: LSL-Pole-V411L mutant mice were generated by microinjecting into pronuclei of C57BL/6J zygotes a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul sgRNA (single guide RNA with spacer sequence AGTGGAGGCTCAAGTGGCAT (Millipore Sigma) ...
-
bioRxiv - Cancer Biology 2024Quote: Pole D272A E274A mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul each crRNA (spacer sequence AGGGAATTTGAGAGGCAGTT ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 to 5 x 104 cells/cm3 for protein harvest) onto culture plates coated with 50 µg/ml Poly-D-Lysine (PDL, Sigma Aldrich) and 20 µg/ml Cultrex™ 3D-laminin (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 30 μg of protein was separated on a 12% polyacrylamide gel and transferred onto a PVDF membrane (Immobilon-P, Millipore, IPVH00010) in a 20 mM Tris ...
-
bioRxiv - Cancer Biology 2024Quote: Pole L424V mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul each crRNA (spacer sequence TGTGGGCAGTCATAATCTCA ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50 μg of protein lysate was electrophoresed on 12% SDS-polyacrylamide gels and transferred to PVDF membranes (EMD Millipore, Burlington, MA). After blocking with 5% milk ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were incubated with HRP-tagged secondary antibodies and protein bands were detected using ECL Prime western blotting system (Catalog No. GERPN2232, Millipore Sigma). Protein band density was measured using ImageJ 1.52a ...
-
bioRxiv - Biochemistry 2024Quote: ... The pure fractions from each protein were pooled and concentrated using an Amicon 5 mL 10,000 MWCO centrifugal concentrator (Millipore Sigma, Inc.) for downstream filamentous complex formation.
-
bioRxiv - Biochemistry 2024Quote: ... Equal amounts of protein samples (30 μg) were loaded per lane and submitted to electrophoresis (SDS-PAGE) in gels containing trichloroethanol (Sigma-Aldrich). Proteins were transferred into 0.2 μm nitrocellulose membranes (BioRad) ...
-
bioRxiv - Immunology 2024Quote: ... Cells were pelleted and supernatant incubated with 7.5 µg precipitating antibody and 100 μL Protein A Sepharose slurry (Sigma-Aldrich, P3391) (5% w/v in lysis buffer) ...
-
bioRxiv - Microbiology 2024Quote: ... Equivalent amounts of total protein were loaded into a 12% SDS-PAGE for electrophoresis and then transferred into a PVDF membrane (Millipore, USA). After blocking nonspecific binding with 5% skimmed milk in TBST ...
-
bioRxiv - Neuroscience 2024Quote: ... and eluted in 30ul elution buffer (protein loading buffer [Thermo 39001] diluted to 1x, 20mM DTT [MilliporeSigma D9779], and 2mM biotin [Sigma B4639]) at 95C for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Gels were equilibrated in pre-chilled transfer buffer with 15% methanol and then protein was transferred to a 0.45 µm nitrocellulose membrane (Sigma catalog# 10600002) via wet electroblotting on ice for 1 h at 300 mV ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein expression was induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) (EMD Millipore Corp.; Cas: 367-93-1). Cells were then incubated for 18 to 20 hours at 20°C at 200 rpm ...
-
bioRxiv - Genetics 2024Quote: ... A total protein of 800 µg was incubated overnight with 40 µL of anti-V5 agarose beads (Sigma-Aldrich, cat. #A7345). After incubation ...
-
bioRxiv - Plant Biology 2024Quote: ... To quantify the concentration of purified protein in the samples a Bicinchoninic acid (BCA) assay was conducted using the BCA kit following the manufacturer recommendations (Sigma Aldrich).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: We determined the protein for all oxidative stress parameters according to the Coomassie blue method using the serum bovine albumin (Sigma Aldrich) as a standard ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total protein 20 ug were separated by SDS-PAGE and further transferred onto 0.2 um PVDF membrane (Millipore, Cat. No. IPVH00010) pre-soaked with ethanol ...
-
bioRxiv - Plant Biology 2024Quote: 5 μg kinase OsDMI3-GST was incubated with 5 μg substrates (OsPrx20-His, Os Prx20T244A-His, or myelin basic protein [MBP; Sigma-Aldrich]) in kinase reaction solution for 30 min as described previously (Shen et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of proteins were loaded onto polyacrylamide gels (8-12%) under reducing conditions and transferred to Immobilon-P membranes (EMD Millipore). After blocking with 5% BSA (wt/vol ...
-
bioRxiv - Genetics 2024Quote: ... 10 µg of total protein was reduced by incubation at RT for 20 minutes with 1 µl 10 mM dithiotrytol (Sigma-Aldrich) followed by incubation for 20 minutes at RT in the dark with 1 µl 50 mM chloroacetamide (Sigma-Aldrich) ...