Labshake search
Citations for Millipore Sigma :
9701 - 9750 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and 2 mg/mL doxycycline (Sigma) to initiate NGN2 overexpression ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/mL puromycin (Sigma). Medium was exchanged daily with fresh medium for three additional days ...
-
bioRxiv - Neuroscience 2024Quote: ... and rotenone (2 μM, Sigma-Aldrich), an inhibitor of mitochondrial complex I ...
-
bioRxiv - Microbiology 2024Quote: ... with 2% Yeast Extract (Sigma, Y1625) at 37°C with 5% CO2 until they reached an OD600 of 0.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... RU486 2 µM (Sigma, cat# M8046), CHX 1 µg/ml (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... 0.05 µM 2-mercaptoethanol (Sigma-Aldrich) and 100 U/ml human IL-2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... and shCdk5rap2-2 (GCCATCAAGATACGATTCATT) (Sigma, TRCN0000183538).
-
bioRxiv - Microbiology 2023Quote: ... 2 mM L-glutamine (Sigma Aldrich), 15 mM HEPES (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM L-glutamine (Sigma Aldrich), and non-essential amino acids (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg/ml of DAPI (MilliPore) was added to stain nuclei ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2 mM Na2S (Sigma-Aldrich) which are inhibitors of electron transport chain ...
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... Phosphatase Inhibitor Cocktail 2 (Sigma P5726) and Phosphatase Inhibitor Cocktail 3 (Sigma P0044) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2-DG (Sigma-Aldrich, #D8375-1G) was weighted using a precision balance and diluted in the corresponding volume of NDiff227 to reach the desired concentration of 2mM and 5mM.
-
bioRxiv - Developmental Biology 2023Quote: ... + 10% 2-Mercaptoethanol (Sigma-Aldrich, #M6250) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.1 mM 2-mercaptoethanol (Sigma)) with 20% KnockOut Serum Replacement (KSR ...
-
bioRxiv - Biophysics 2023Quote: ... coli Rosetta 2 pLysS (EMD Millipore), and 1 L cultures were grown at 37°C in 2XYT media to an OD600 of 0.6 before induction with 0.25 mM IPTG at 20°C for 16-18 hours ...
-
bioRxiv - Immunology 2023Quote: ... and 2 mM EDTA (Sigma-Aldrich)) for further 20 min on ice with the following antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM MgCl2 · 6H2O (Sigma-Aldrich), 2 mM EGTA (Sigma-Aldrich) ...
-
bioRxiv - Pathology 2023Quote: ... LPS 2 mg/kg (Sigma Co.) was injected into the vein at the margin of the ear ...
-
bioRxiv - Immunology 2024Quote: ... and 2-mercroptoehanol (BME) (Sigma-Aldrich). Samples for Western blotting were subjected to electrophoresis on 4–12% Bis-Tris gels (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2-deoxy-glucose (Sigma-Aldrich) following a protocol of 1.5-min mix ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 % Penicillin-Streptomycin (Sigma-Aldrich, P4333), 0.1 % Rock Inhibitor (Y-27632 dihydrochloride ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM L-glutamine (Sigma-Aldrich), and 40 U/mL penicillin-streptomycin (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM L-glutamine (Sigma-Aldrich), 100 units/ml penicillin ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 2 mM glutamine (Sigma, G8540), 3 mg/mL bovine serum albumin (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... and 2-mercaptoethanol were from Sigma, LPS was from Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... 2-DG (50 mM, Sigma-Aldrich). Glycolytic flux was also measured by detritiation of [3-3H]-glucose (Perkin Elmer ...
-
bioRxiv - Immunology 2024Quote: ... 2-DG (100 mM; Sigma-Aldrich) or a combination of drugs ...
-
bioRxiv - Immunology 2024Quote: ... 2-DG (100 mM; Sigma-Aldrich), oligomycin (1 μM ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% 2-mercaptoethanol (Sigma Aldrich). Samples were boiled for 10 minutes at 95°C before separation on a gradient of 4-20% SDS-PAGE gels (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 mM Glutamine (Sigma, G7513). Two group of sequential drug injections were used ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 mM Glutamine (Sigma, G7513). ATP-synthetase inhibitor Oligomycin (1.5 µM final/well ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2 volume ethanol (Sigma, E7023) to perform EtOH precipitation,[51] and the dsDNA pellet was resuspended in 5 mM Tris in ddH2O ...
-
bioRxiv - Biophysics 2024Quote: ... Molten 2% pure agarose (Sigma Aldrich) solution was poured onto the spheroid micro-mould (#12-256-Small ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mm l-glutamine (Sigma, G7513) and 100 U·mL−1 penicillin/100 μg·mL−1 streptomycin (Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2% antibiotics (penicillin/streptomycin, Sigma). MSCs were used at passage 4 and MG63s at passage < 20 ...
-
bioRxiv - Biophysics 2024Quote: ... 2 mM amino acids (Sigma-Aldrich), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
bioRxiv - Bioengineering 2024Quote: ... with 2 mM EGTA (Sigma, E3889) at room temperature for 30 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM adenosine triphosphate (ATP) (Sigma), and 0.3 mM syntide (LifeTein) ...
-
bioRxiv - Cell Biology 2024Quote: ... 2% normal donkey serum (Sigma-Aldrich), and 0.2% Triton X-100 (Teknova ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM Taurine (Sigma Aldrich, T0625), 2 mM L-carnitine (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM l-Glutamine (Sigma-Aldrich), 1 mM Sodium Pyruvate (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... and 2 % penicillin-streptomycin (P0781, Sigma). Prior cell seeding ...
-
bioRxiv - Cancer Biology 2023Quote: ... si-mmu-Sox4-2 (Sigma # SASI_Mm01_00114972), si-has-SOX4 (Sigma # SASI_Hs01_00188751 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50 µM 2-Mercaptoethanol (Sigma Aldrich) and 1x penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg/ml Ionomycin (Sigma-Aldrich) and Brefeldin (1/1000 ...
-
bioRxiv - Bioengineering 2024Quote: ... or malachite green (+2) (32745, Sigma). Closed DNA origami (3 µM ...
-
bioRxiv - Genomics 2023Quote: ... 2 µM Y-27632 (Millipore, 688000)) and placed in the incubator at 37°C (21% O2 ...
-
bioRxiv - Genetics 2023Quote: ... 2 mM Trolox (Sigma-Aldrich, 238813), 0.5 mg/mL glucose oxidase (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2% (v/v) deionized formamide (Millipore), 10 ng/μl ET SSB (New England Biolabs) ...