Labshake search
Citations for Millipore Sigma :
9651 - 9700 of 10000+ citations for 192 IgG Mouse Monoclonal Cy3 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and Duolink In Situ PLA Probe Anti-Mouse MINUS (DUO92004, Sigma-Aldrich) we incubated with coverslip 60 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary antibodies used were mouse anti-α-SMA (clone 1A4, Sigma-Aldrich) 1:10 000 ...
-
bioRxiv - Cell Biology 2020Quote: The mouse anti-ubiquitin (FK2) used for immunofluorescence was from EMD Millipore. Hoechst dye was from Sigma and Alexa Fluor-conjugated secondary antibodies were from Molecular Probes ...
-
bioRxiv - Immunology 2021Quote: ... secondary antibody: anti-mouse-Alexa 594 at 1:1000 (Millipore Sigma, F0257). Images were taken at 100X magnification on Lionheart (Biotek).α-SMA area was analyzed using ImageJ (NIH) ...
-
bioRxiv - Immunology 2021Quote: ... followed by a mouse anti-rabbit Alexa Fluor 488 secondary antibody (Sigma) and Vybrant DyeCycleViolet Stain (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse livers were fixed in 10% formalin buffer saline (HT501128, Sigma Aldrich) for 24h at room temperature before paraffin embedding ...
-
bioRxiv - Molecular Biology 2021Quote: ... β-actin was used as a loading control (mouse Mab Sigma A2228). Five U/μg DNA of DNase (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse anti-cadherin-11 (clone 16A) antibody was from Millipore (Billerica, MA). Mouse anti-cadherin-11 (clone 5B2H5) ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-α-tubulin (1:10 000; Sigma-Aldrich Cat# T8328, RRID:AB_1844090), rhodamine peanut agglutinin (1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mouse anti-Lamin A/C at 1:50 (Sigma-Aldrich #MABT1340).
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse anti-acetylated-a-tubulin antibody (T7451, 1:1000 dilution, Sigma) were used for immunofluorescence ...
-
bioRxiv - Neuroscience 2022Quote: ... for Mouse 448 and human experiments or 1 mg/ml Hoechst (Sigma) for the mouse atlas experiments ...
-
bioRxiv - Immunology 2022Quote: ... the DuolinkTM InSitu Orange Starter Kit Mouse/Rabbit (DUO92102) from Sigma Aldrich was used ...
-
bioRxiv - Neuroscience 2022Quote: ... or mouse anti-TPH2 primary antibody (1:100 dilution, T0678, Sigma-Aldrich). The secondary antibodies used were donkey anti-mouse Alexa 488 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were stained with primary mouse antibodies anti-FLAG M2 (Sigma, F1804) or anti-dsRNA J2 (Jena Bioscience ...
-
bioRxiv - Biochemistry 2022Quote: ... Membranes were incubated with primary antibody (mouse anti-FLAG M2, Sigma F1804) at 1:1000 dilutions in 3% milk-TBS-T overnight rotating at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-tyrosine hydroxylase (1: 5000; Sigma, St. Louis, MO, Cat#T1299), chicken anti-tyrosine hydroxylase (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-NeuN (clone A60, 1:500; Millipore, Billerica, MA Cat#MAB377), rat anti-BrdU (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies assessed include mouse anti-ATXN3 (1H9) (1:500; MAB5360; Millipore) and rabbit anti-Olig2 (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... or mouse anti-GFAP (1:500 dilution; Milipore Sigma cat. no. G3893) + rabbit anti-VCAM1 (1:200 dilution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Membranes were incubated overnight with mouse anti-GFP primary antibody (Sigma-Aldrich) used at 1:1000 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:1000 mouse-anti-α-SMA (Millipore; Burlington, MA; Clone ASM-1), 1:2000 mouse-anti-β-actin (Cell Signaling Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: mouse α-tubulin (1:1000, Sigma T9026) and rabbit α-Cenp-C (Pauleau ...
-
bioRxiv - Genomics 2020Quote: ... Mouse Embryonic fibroblasts were crosslinked using 1% formaldehyde (Sigma cat. No. F8775) for 10 minutes followed by quenching with 0.125 M Glycine for 5 minutes and lysis with lysis buffer 1 -LB1- (50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Horseradish peroxidase-conjugated with anti-rabbit HRP and anti-mouse HRP (Sigma) were the secondary antibodies used ...
-
bioRxiv - Molecular Biology 2019Quote: ... Blastocysts were cultured on irradiated mouse embryo fibroblasts (PMEF-N, Millipore Sigma) in ESGRO-2i medium (Millipore Sigma SF016-100 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Commercial available antibodies are mouse anti-Flag (1:1000, Sigma, M2, F3165), and mouse anti-α-tubulin (1:150 ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies were detected by Texas Red-conjugated goat-anti mouse (Sigma) or FITC-conjugated goat anti-rabbit (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... p62-Alexa Fluor 488 mouse antibody for flow cytometry was from Millipore or R&D Systems ...
-
bioRxiv - Developmental Biology 2019Quote: ... followed by rabbit anti-mouse collagen type IV (Millipore, AB756P, 1:200) or rat anti-mouse CD31 (BD Biosciences ...
-
bioRxiv - Cell Biology 2019Quote: ... The primary antibodies used were mouse anti-Flag (1:1,000, Sigma-Aldrich), rabbit anti-Flag (1:1,000 ...
-
bioRxiv - Immunology 2019Quote: ... Sections were stained with primary Abs (rabbit anti-mouse laminin (Sigma Aldrich), Alexa fluor 594 Goat anti-mouse IgM (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... then incubated with primary antibodies (mouse anti-PAR, 1:400 Merck Millipore Cat#AM80 RRID ...
-
bioRxiv - Microbiology 2019Quote: ... The following antibodies were used: mouse anti-γH2AX (EMD Millipore, Billerica, MA), rabbit anti-53BP1 (Novus Biologicals ...
-
bioRxiv - Microbiology 2019Quote: ... and tagged proteins were detected with mouse anti-GFP (Sigma, 1:5,000), rat anti-HA (Sigma 3F10 clone ...
-
bioRxiv - Developmental Biology 2019Quote: ... Genotyping was performed using the KAPA HotStart Mouse Genotyping Kit (Sigma, KK7352) using GFP primers ...
-
bioRxiv - Cell Biology 2019Quote: ... Horseradish peroxidase–conjugated secondary antibody (anti-mouse) was obtained from Sigma-Aldrich. For Western blotting ...
-
bioRxiv - Neuroscience 2019Quote: ... Mouse anti-β-actin primary antibody (1:5000) was from Sigma-Aldrich.
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Molecular Biology 2019Quote: ... Slides were incubated with primary 1:1000 mouse α-Tub1a (Sigma -T6793) antibody and detected with 1:200 anti-rabbit CY3 (Jackson Immunoreserach ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-mouse tyrosine hydroxylase (TH; 1:1000; Millipore Sigma, Cat# MAB318, RRID:AB_2313764), or anti-rabbit NeuN (1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... (mouse) from DSHB and 1:1000 anti Actin (Rabbit) A5060 from Sigma and 1:1000 for anti-dPIP4K antibody (Rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... We also used mouse anti-puromycin clone 12D10 (1:1000, EMD Millipore), rat anti-LAMP1 (1:200 ...
-
bioRxiv - Genetics 2020Quote: ... anti-mouse secondary antibody tagged with alkaline phosphatase (Sigma, catalogue no: A3562), CDP star (sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1/800 mouse anti-beta-3-tubulin (T5758, Sigma, St. Louis, MO), 1/100 anti-mouse-TRPV1 (sc-398417 ...
-
bioRxiv - Neuroscience 2020Quote: ... Antibodies used were mouse anti-NeuN (1:250, Millipore, Burlington, MA, #MAB377), chicken anti-NF200 (1:250 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-<ι>α-Tubulin (Millipore T9026, clone DM1A; 1:10,000). Secondary antibodies were incubated in 5% BLOT-QuickBlocker (G-Biosciences 786-011 ...
-
bioRxiv - Neuroscience 2020Quote: ... a mouse anti-parvalbumin polyclonal antibody (1:1000, catalog: P3088, Sigma Aldrich) and a rabbit anti-vasoactive intestinal peptide (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-mouse and anti-rabbit HRP-conjugated antibodies were from Sigma-Aldrich. Alexa488-conjugated Phalloidin was from Thermo Fisher ...