Labshake search
Citations for Millipore Sigma :
9551 - 9600 of 10000+ citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and 400 μM of 5-Chloro-2′-deoxyuridine thymidine (CldU) (Sigma-Aldrich) for exactly 20 min each ...
-
bioRxiv - Developmental Biology 2021Quote: ... N,N,N’,N’-tetrakis(2-hydroxypropyl)ethylenediamine (Sigma, 5% (w/w)) ...
-
bioRxiv - Developmental Biology 2021Quote: ... with BMP4 (1 ng/ml, R&Dsystem) and Thiazovivin (2 microM, Millipore). On day 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50 ng/ml R-Spondin and 2 μM CHIR99021 (Sigma-Aldrich; SML1046).
-
bioRxiv - Developmental Biology 2021Quote: ... Lysis buffer containing 5X Laemmli buffer with 10% 2-Mercaptoethanol (Sigma, M3148) was added to the beads ...
-
bioRxiv - Developmental Biology 2020Quote: ... with BMP4 (1 ng/ml, R&Dsystem) and Thiazovivin (2 μM, Millipore). On day 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... dried peptides were resuspended in 2.5 % 1,1,1,3,3,3-Hexafluoro-2-propanol (Sigma-Aldrich) / 0.1 % TFA prior to LC-MS measurement ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Pictures were acquired using a FSL confocal microscope (Olympus).
-
bioRxiv - Molecular Biology 2021Quote: ... animals were immobilized on 2% agarose pads supplemented with 100mM Levamisole (Sigma).
-
bioRxiv - Neuroscience 2021Quote: ... we injected 2 μl of 2.5% lysolecithin (LPC, α-lysophosphatidylcholine, Sigma L4129) dissolved in PBS into the corpus callosum of 9-to 12-week-old mg-Nrp1-cont and mg-Nrp1-cko mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerized microtubules were stabilized with 2 µM Taxol in BRB80 (Sigma T1912). 10-20 µl of freshly prepared or freshly thawed ODA at ∼100 µg/ml concentration was applied to a flow chamber and allowed to adhere to glass for 2 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... DL-2-amino-5-phosphopentanoic acid (AP5, 50uM; Sigma-Aldrich, Oslo, Norway) was added to the ACSF in order to block NMDA receptor-mediated synaptic plasticity.
-
bioRxiv - Molecular Biology 2021Quote: ... 150mM NaCl and 2 mM EDTA and Protease inhibitors (Sigma–Aldrich P5726). Wash buffer was prepared as follows ...
-
bioRxiv - Molecular Biology 2020Quote: Cardiac tissue (porcine) was fixed with 2% paraformaldehyde (PFA, pH 7.4, Sigma) for 1 hour at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were then labelled with 4,6-diamidino-2-phenylindole (DAPI) (Sigma, D9542) at a final concentration of 1 μg/mL in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 ml 40% glyoxal solution (Sigma 50649, we do not deionise this), 1.2 ml 10x BPTE ...
-
bioRxiv - Molecular Biology 2021Quote: ... transduced organoids were selected with 2 μg/ml of puromycin (Sigma-Aldrich). After which clones were expanded in maintenance ENR medium ...
-
bioRxiv - Cell Biology 2022Quote: ... selection was performed with 1–2 μg/mL puromycin (P8833; Sigma-Aldrich) or 2–3 μg/mL blasticidin (022-18713 ...
-
bioRxiv - Biochemistry 2020Quote: Escherichia coli strain BL21(DE3) Rosetta-2 pLysS (Novagen Merck, Darmstadt Germany) was transformed with pET28a-His6-CrTRXz and grown in 1 L of 2YT medium supplemented with kanamycin (50 µg.mL-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidine-2’-phenylinedole dihydrochloride (DAPI) were purchased from Sigma (MO, USA). The primary antibody raised against DMT1 was purchased from Santa Cruz Biotechnology (CA ...
-
bioRxiv - Immunology 2019Quote: ... The plates were then blocked with 2% of bovine serum albumin (Sigma) in PBS with 0.05% Tween 20 (PBST ...
-
bioRxiv - Genetics 2019Quote: The 2 dpf zebrafish embryos were anesthetized with 0.03% Tricaine (Sigma-Aldrich), mounted in 3% methylcellulose and imaged using a Zeiss Stemi 2000 Stereo microscope ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... and 50µg/ml 2-Phospho-L-ascorbic acid trisodium salt (Sigma-Aldrich). After removal of the bone marrow ...
-
bioRxiv - Cell Biology 2019Quote: ... and 50µg/ml 2-Phospho-L-ascorbic acid trisodium salt (Sigma-Aldrich). Half medium changes were made every other day during induction period and mineralising-medium was made up fresh every time ...
-
bioRxiv - Neuroscience 2019Quote: ... fish were anesthetized following immersion in 2-phenoxyethanol (Sigma-Aldrich, 1:2000). All pharmacological agents were dissolved in 0.9% NaCl or in DMSO depending on solubility ...
-
bioRxiv - Biophysics 2019Quote: ... cells were fixed with 2 % paraformaldehyde (PFA; Sigma Aldrich, cat. no. 158127) at RT ...
-
bioRxiv - Immunology 2020Quote: ... Nuclei were counterstained with 4’,6’-Diamidino-2-phenylindole (DAPI; #D9564; Sigma) diluted 1/1500 in PBS/Ca/Mg for 5min ...
-
bioRxiv - Immunology 2019Quote: ... the MTT (3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Sigma-Aldrich) powder is re-suspended into PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Imaging of cells was carried out in epifluorescence and differential interference contrast (DIC ...
-
bioRxiv - Microbiology 2019Quote: Protease activity: The activity of protease was determined with 2% azocasein (Sigma) (30) ...
-
bioRxiv - Physiology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylidole, 1 μg/mL, Sigma-Aldrich, Israel) was added followed by fluorshield (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... plasmids were mixed with 2 mg/ml Fast Green (Millipore Sigma, F7252). In all conditions ...
-
bioRxiv - Plant Biology 2019Quote: For DAPI staining (4′,6-diamidino-2-phenylindole; Sigma, St. Louis, MO), transfected leaf discs were cut and placed in DI water with 5 µg/ml DAPI for 30 min prior to mounting in DI water for imaging ...
-
bioRxiv - Immunology 2019Quote: ... In EdU and BrdU (5-bromo-2′-deoxyuridine, cat# B5002-500mg, Sigma) labelling experiments mice were injected first with 1 mg EdU (cat #E10415 ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were plated on a poly 2-hydroxyethyl metracrylate (poly HEMA) (Sigma) pre-coated 75 cm2 flask to avoid adhesion ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: ... positive cells were selected with 2 μg/ml puromycin dihydrochloride (Sigma-Aldrich) in growth media for 5 days ...
-
bioRxiv - Bioengineering 2019Quote: ... and 0.25 mg mL−1 L-ascorbic acid 2-phosphate (Sigma; A8960)) to allow for protein adsorption.
-
bioRxiv - Cell Biology 2019Quote: ... Doxycycline (1µg/ml) and thymidine (2 mM) was purchased from Sigma-Aldrich, nocodazole (3.3 µM ...
-
bioRxiv - Immunology 2019Quote: ... Firrerescue MEFs were cultured with either 2 ug/mL dox (Sigma, D9891) or vehicle (ddH2O ...
-
bioRxiv - Developmental Biology 2019Quote: ... or 5-Bromo-2’deoxyuridine (BrdU; Sigma-Aldrich Corp., St. Louis, MO). Embryos were incubated on ice in 1.5 mM EdU dissolved in embryo rearing solution containing 15% diethylsulfoxide for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 μM Cytosine b-D-arabinofuranoside (Ara-C; Sigma-Aldrich C1768-100MG) was added to remove any proliferating cells ...
-
bioRxiv - Molecular Biology 2019Quote: ... The chromatin sample was homogenized by adding 2 μl Benzonase (Sigma, E1014) and mixing with a 1-ml syringe and 22G needle ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM glutamine and 1% non-essential amino acids (Sigma-Aldrich, UK). All cell lines were maintained in 5% CO2 in a humidified incubator at 37°C and free from mycoplasma contamination as determined by the EZ-PCR Mycoplasma kit (Biological Industries ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Plant Biology 2019Quote: ... and 2 μL melezitose 50 mM (Sigma Aldrich; St. Louis, Missouri, USA), as an internal standard ...
-
bioRxiv - Biochemistry 2019Quote: ... followed by induction of Nek10 expression with 2 μg/ml doxycycline (Sigma) for several days ...
-
bioRxiv - Synthetic Biology 2019Quote: ... cells were stimulated for 2 hours with PMA (50 ng/ml Sigma), ionomycin (1nM ...
-
bioRxiv - Systems Biology 2020Quote: ... Briefly Caco-2 or C2BBe1 along with HT29-MTX-E21 cells (Sigma) were seeded onto rat-tail collagen I-(corning 354236 ...
-
bioRxiv - Neuroscience 2019Quote: ... rapidly frozen in dry-ice-cooled isopentane (2-methylbutane; Sigma-Aldrich, 277258) at approximately – 35°C ...