Labshake search
Citations for Millipore Sigma :
901 - 950 of 10000+ citations for PD 1 Human HEK293 mFc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Anti-human IgM-alkaline phosphatase (Sigma Aldrich) (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... chicken anti-human MAP2 (EMD Millipore, AB5543), mouse anti-human synapsin (SYSY,106011) ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μg/ml human insulin (Sigma-Aldrich), 10 ng/ml recombinant human EGF (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... FN from human plasma (Sigma-Aldrich, F2006) was adsorbed from solutions of 20 µg/ml for 1 h a room temperature (RT ...
-
bioRxiv - Physiology 2024Quote: ... Human male plasma was obtained from Sigma (H4522 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 ng of recombinant human AChE (Sigma) or 30 μg of tissue lysate was incubated with steroidal alkaloid compound or at room temperature for 30 minutes in 50 mM Tris pH 8.0 in a total volume of 90 μL ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant human IFN-α2a (H6041; Sigma-Aldrich) was reconstituted in PBS with 0.1% BSA and added to the basolateral pole at a final concentration of 100 U/ml ...
-
bioRxiv - Immunology 2024Quote: ... 5% human AB serum (Sigma-Aldrich, UK). NK cells were expanded with cytokines IL-2 (500 U/ml) ...
-
bioRxiv - Immunology 2024Quote: ... containing 5% human serum (Sigma, Darmstadt, Germany) for 24 hours (1 million cells per well in 96-well plates ...
-
bioRxiv - Biochemistry 2024Quote: ... type IV (human placenta; Sigma-Aldrich C5533) and type V (human placenta ...
-
bioRxiv - Bioengineering 2024Quote: ... HDL from human plasma (Sigma-Aldrich, SAE0054), LDL from human plasma (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... LDL from human plasma (Sigma-Aldrich, SAE0053), VLDL from human plasma (Millipore Sigma ...
-
bioRxiv - Bioengineering 2024Quote: Human serum was obtained from Sigma-Aldrich. Rat serum was obtained from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3% human AB serum (Sigma-Aldrich, H4522), 3 U/ml heparin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: The cDNA residues 1-169 of human Rheb (184 amino acid isoform, GenBank accession number EAW53989) was subcloned into the pET28a vector (Novagen), with an N-terminal 6×His-tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... These wells were washed five times using 1× PBST and followed by addition 50 μl/well of anti-human IgG horseradish peroxidase (HRP) (Sigma) diluted in Stabilzyme Noble (Surmodics) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Metastases and micro-metastases were assessed using IHC with a human mitochondria antibody (Millipore MAB1273 Anti-Mitochondria clone 113-1).
-
bioRxiv - Bioengineering 2019Quote: ... and subsequently incubated overnight with the Notch ligand Delta-1 (courtesy of the Bernstein Lab, FHCRC) or human IgG (Sigma) to achieve oriented immobilization ...
-
bioRxiv - Biochemistry 2019Quote: The DNA construct coding for the motor domain of human kinesin-5 (Eg5; residues 1–368) was cloned into a modified pET16b (Novagen) vector for bacterial expression to achieve an N-terminally 6x His tag and TEV cleavage sequence ...
-
bioRxiv - Biochemistry 2020Quote: ... The samples were incubated at 30°C for 15 or 30 minutes in the presence of 750 nM DCLK1 and 0.617 μg human calpain 1 (Sigma, C6108), then analyzed by SDS-PAGE.
-
bioRxiv - Neuroscience 2020Quote: ... Sandwich ELISA kits for quantitative detection of human Aβ 1-40 peptides in a flexible 96 well format were purchased from Millipore (cat ...
-
bioRxiv - Immunology 2020Quote: ... from 1:50 to 1:51200 in PBS containing 2% skimmed milk were added followed by ALP-conjugated anti-human IgG (A9544; Sigma) at 1:10,000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 5% heat-inactivated AB human serum, antibiotics (penicillin, 200 U/ml; and streptomycin, 0.1 mg/mL) and L-glutamine (1 mM) (Sigma-Aldrich) at a concentration of 1 x 107 cells/mL ...
-
bioRxiv - Immunology 2021Quote: ... that utilizes the same human antibodies.12 Antibodies were prepared 1:500 in carbonate-bicarbonate coating buffer (SRE0034, Sigma-Aldrich), added to each well of a Costar 96-well Assay plate (3369 ...
-
bioRxiv - Microbiology 2019Quote: ... the slides were incubated for 2 hours at room temperature with 1 µg/mL Cy3-conjugated goat anti-human IgG (H+L) (Sigma) and washed again ...
-
bioRxiv - Microbiology 2022Quote: ... These wells were washed five times using 1× PBST and followed by addition 50 μl/well of anti-human IgG horseradish peroxidase (HRP) (Sigma) diluted in Stabilzyme Noble (Surmodics) ...
-
bioRxiv - Neuroscience 2022Quote: ... The sample was then washed twice with 2X SSC and digested by 3 incubations (10 minutes for mouse and 5 min for human) with digestion buffer containing 1% (w/v) sodium-dodecyl-sulfate (SDS, Sigma), 20 mM Tris HCl (Thermo) ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Plates were washed with TBS containing 0.2% Tween and incubated for 1 hour at 37°C with Goat anti-human Fc (Sigma, A9544) or Fab (Jackson immunoResearch AB_2337617 ...
-
bioRxiv - Pathology 2021Quote: ... postmortem kidney was fixed in 20% formalin for 2 weeks and processed for free-?oating preparation as done for mouse tissue with one exception that anti-human CD31 antibody (CBL468, 1:20 dilution, Millipore) was used.
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... plates were washed 4 times with PBST and further incubated with 100 μL per well of goat anti-human IgG (Fc specific)-Peroxidase antibody (1: 5000 dilution, Sigma) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated 30 seconds in plasma cleaner then coated with cell-specific adhesive surface: for at least 1 hour with 10 μg/ml recombinant human fibronectin (Sigma) for Hela and SHSy-5Y cells ...
-
bioRxiv - Microbiology 2020Quote: rAkata EBV-infected cells was reactivated at 1×106 cells/mL with a goat polyclonal anti-human IgG Fc-specific antibody (Sigma) for 48 hours ...
-
bioRxiv - Immunology 2022Quote: ... Stable knockdown of human LRBA was generated by lentiviral transfection with the short hairpin (sh) RNA expressing vector pLKO.1 (SIGMA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... The infectious blood meal consisted of a 2:1 mix of washed human erythrocytes and viral suspension supplemented with 10 mM ATP (Sigma). The infectious titers were 107 FFU/mL for DENV-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... To assess the NOTCH3 ECD deposits the tissues were incubated overnight at 4 °C with mouse monoclonal anti-human NOTCH3 ECD primary antibody (1:100, clone 1E4, Millipore) followed by detection with Alexa 594 conjugated anti-mouse secondary antibody (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... Alkaline phosphatase (AP)-labeled goat anti-human IgM (μ-chain specific; Sigma-Aldrich, Vienna, Austria; 1:50,000 in TBS BSA), AP-labeled goat anti-human IgG (γ-chain specific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 (human retinal pigment epithelial) cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Molecular Biology 2023Quote: ... The process was the same as in fibroblasts and the primary antibodies were anti-human NANOG (1:100, Millipore #AB5731) and SSEA4 (1:25 ...
-
bioRxiv - Genetics 2023Quote: ... Then cells were resuspended in the BD-FACS staining buffer and labelled through anti-human TRA-1-60 antibody (Millipore) and anti-mouse IgM control ...
-
bioRxiv - Bioengineering 2023Quote: ... encoding the human KRASG12V and KRASY64A mutants (residues 1–169) and human SOS1 (residues 564–1049) were cloned as NdeI and XhoI fragments into pET28b (Novagen). His-tagged KRAS•GDP (abbreviated RAS ...
-
bioRxiv - Cell Biology 2022Quote: ... and Mirg-/-littermates injected subcutaneously with Growth factor-reduced Matrigel BD) with 400 ng mL-1 recombinant human bFGF (Millipore). After 7 days Matrigel plugs ...
-
bioRxiv - Immunology 2023Quote: ... in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich) for 40 minutes at 4 °C ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... Immunofluorescence in human cells was conducted as previously described using antibodies against tubulin (1:1000 anti-beta tubulin, mouse, T7816, Sigma OR 1:2000/1:1000 anti-alpha tubulin ...
-
bioRxiv - Immunology 2023Quote: ... The wells were washed with PBS-0.1% Tween 20 and then incubated with 100 μl of 100 μg/well of biotinylated rabbit anti-human C1q (Sigma) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... The antibodies used in this study were: polyclonal rabbit anti-human HINT1 antibody (1:1000, Sigma, San Luis, MO, USA), and to demonstrate equal loading mouse monoclonal anti-β-actin antibody (1:5000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Polyacrylamide gels were then immediatly coupled to either human plasma fibronectin (1 mg/mL overnight at 37◦C; FC010, Millipore) or ICAM-1 (0.1 mg/mL Recombinant Protein A (Novex ...
-
bioRxiv - Biochemistry 2023Quote: ... 1:200 dilution of human C-reactive protein (MPBIO) including additional 5 mM CaCl2 or 1:1000 anti-HRP from rabbit (Sigma) in blocking buffer ...