Labshake search
Citations for Millipore Sigma :
901 - 950 of 10000+ citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Day 2 and 3 media consisted of endoderm differentiation (Sigma) base media with added activin A (5 μL/mL) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 6.67 mM [Ru(II)(bpy)3]2+ (Sigma-Aldrich). To produce cylindrical hydrogels for uniaxial traction testing ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by lead citrate for 2–3 minutes (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.4 containing phosphatase inhibitors cocktails 2 and 3 (Sigma). Proteins were separated by SDS-PAGE on a 5% Polyacrylamide gel containing 20 μM Phos-tag (NARD ...
-
bioRxiv - Neuroscience 2023Quote: ... 2-Chloroquinoline-3-carboxylic acid (Sigma-Aldrich, cat. no 688517), 4-Chloro-DL-phenylalanine salt (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 % each phosphatase inhibitor cocktails 2 and 3 (Sigma‐Aldrich), and 25 mM iodoacetamide (Sigma‐Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... and cocktail-2 and cocktail-3 phosphatase inhibitors (Sigma Aldrich)) ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently washed 3 times with PBS 2% FBS (Sigma). pDCs were enriched from freshly isolated PBMCs using the human Plasmacytoid Dendritic Cell Isolation Kit II (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2024Quote: ... a 2% 3-(Trimethoxysilyl)propyl methacrylate (TMSPMA, Sigma-Aldrich 440159) (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: 3% poly-2-hydroxyethyl methacrylate (poly-HEMA; P3932, Sigma-Aldrich) solution was prepared in 95% absolute ethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 purchased from Sigma Aldrich, MO ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: Mice aged 6 months or naked mole-rats aged 2-4 years were given intraperitoneal (i.p.) injections with 150mg/kg 5-Fluorouracil (5-FU; Sigma) from a 50mg/ml stock in DMSO diluted with sterile 0.9% sodium chloride solution (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were cultured for 72 h and then cell death was measured using the tetrazolium dye (2,3)-bis-(2-methoxy-4-nitro-5-sulphenyl)-(2H)-terazolium-5-carboxanilide (XTT) assay (Sigma) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... For this, NHS-CF555 (5 µl, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNP (500 µl) ...
-
bioRxiv - Bioengineering 2022Quote: ... HA-TBA was dissolved in anhydrous DMSO (2 wt%) with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 4’,6-diamidino-2-phenylindole (DAPI)(Sigma-Aldrich) added to the second wash at to a concentration of 300 nM to counterstain DNA ...
-
bioRxiv - Bioengineering 2021Quote: ... The DAPI (4’,6-diamidino-2-phenylindole, Sigma-Aldrich) fluroscence staining was employed for visualizing nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... or (4) 2 mg/mL FITC (Millipore Sigma #1.24546) (Figure S2A) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA). Slides were mounted in Mowiol 4-88 (Calbiochem ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 µM carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone FCCP (Sigma), and 0.5 µM of rotenone (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 5,6,7,8-tetradeutero-4-hydroxy-2- heptylquinoline (HHQ-d4, Sigma) was used as an internal standard ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6’-diamidino-2-phenylindole (DAPI) (Sigma, D9542). For immunofluorescence staining primary antibodies were anti-ACE2 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) at 1 µg/ml at RT for 45 min ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, D9542), Hoechst stain (Invitrogen ...
-
Cyborg islets: implanted flexible electronics reveal principles of human islet electrical maturationbioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, D9542, Sigma-Aldrich) was added and stained for 1 day ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-cis 4-trans-abscisic acid (Sigma, Cat # 862169) at 10µM was prepared in ethanol and sterile filtrated with 0.2 µm filter ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, #D9542) and DRAQ5 (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 × 107 cells were fixed in 4% formaldehyde (Sigma) for 10 minutes at room temperature then quenched with glycine ...
-
bioRxiv - Neuroscience 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich D9542).
-
bioRxiv - Molecular Biology 2022Quote: ... 4 mM tris (2-carboxyethyl) phosphine (TCEP) (Sigma-Aldrich)) with 4% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4′,6-diamidino-2 phenylindole (DAPI, Sigma-Aldrich) (1:2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich, cat# D9542 ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 × 10−4 M L-cystine (C7602, Sigma-Aldrich), 100 μg/mL sodium pyruvate (11360070 ...
-
bioRxiv - Pathology 2024Quote: ... with 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich Chimie ...
-
bioRxiv - Biochemistry 2024Quote: ... a 4X 4-(2-pyridilazo)resorcinol (PAR, Sigma-Aldrich) working solution (400 μM ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, 10236276001, Sigma) was used to label nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(Cyanine 5) (DOPE-Cy5) (Sigma 810335C), all from Avanti Polar Lipids ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Biochemistry 2023Quote: ... Ro 20-1724 [4-(3-butoxy-4-methoxy-benzyl) imidazolidone] was purchased from Sigma Aldrich (catalog no. B8279); stock concentrations were made at 100 mM in DMSO.
-
bioRxiv - Bioengineering 2021Quote: ... The secondary antibodies were washed away with PBS (3x 5 min) whereafter 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) was added for 10 minutes to localize the cell nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclear labelling was achieved by incubating the sections for 5 min in DAPI (4′,6-diamidino-2-phenylindole; 1:5000; Sigma). Two final washes in PBS were performed before the sections were mounted on glass slides using Vectashield (Vector Laboratories ...
-
bioRxiv - Immunology 2024Quote: ... slides were washed in PBS and incubated in 5 μg mL-1 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... in 0.1% BSA/PBS supplemented with 5 μg/ml Hoechst or 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI)) or ExtrAvidinCy3 (Sigma) solution (1:100 in 0.1% BSA/PBS supplemented with 5 μg/ml Hoechst) ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Systems Biology 2020Quote: ... For amino acid derivation 3 μL phthaldialdehyde (Sigma-Aldrich), i.e ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated for 5 min with a 4’,6-diamidino-2-phenylindole (DAPI) solution (Sigma) to stain cell nuclei ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with 5 µg/mL 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Biophysics 2024Quote: ... which was prepared with 20 mM HEPES-buffer (2-(4-(2-Hydroxyethyl)-1- piperazinyl)-ethansulfonsäure) (Sigma-Aldrich, ≥99.5 %, H3375) as calcium chloride is not soluble in DPBS-buffer ...