Labshake search
Citations for Millipore Sigma :
901 - 950 of 10000+ citations for 6 ethyl 3 pyridinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, Sigma) was used at a 1:1000-1:2000 dilution for DNA staining.
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Sigma, #MBD0015) and TRITC-conjugated Phalloidin (Cell Signaling ...
-
bioRxiv - Plant Biology 2023Quote: ... paclobutrazol (PAC) (Sigma-Aldrich; 10−6 M), and mock solutions were applied to plants by watering as described (Silva et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 6% bovine serum albumin (Sigma, #AA0281) solution ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µL of 2-mercaptoethanol (Sigma-Aldrich), and 0.2 g of glass beads ...
-
bioRxiv - Zoology 2024Quote: ... (6) treated with antibiotics (penicillin streptomycin, Sigma P4333 ...
-
bioRxiv - Plant Biology 2024Quote: ... urea (CAS no. 57-13-6, Sigma), SR2200 (Renaissance Chemicals) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 6 mM cis-aconitate (Sigma-Aldrich) at 28°C ...
-
bioRxiv - Genetics 2023Quote: ... 6-hexanediol (Sigma, catalogue no.240117-50G), or various redox states (68) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 6% bovine serum albumin (Sigma, #AA0281) blocking solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) was done concurrently ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-mercaptopurine (852678-5G-A Sigma Aldrich), mizoribine (S1384 Selleck Chemicals) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Hyaluronidase (Sigma, H3506, 6 U/mL final) and Collagenase XI (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma) and/or with SytoxTM Green Nucleic Acid Stain (1:30.000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) and the images were captured under a Leica DMRXA microscope equipped with a Leica DFC310 FX camera (Leica Microsystems).
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole (Millipore) was used at 1:5,000 dilution.
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma, USA) to confirm representative target location ...
-
bioRxiv - Biochemistry 2024Quote: ... using 6–8 kDa MWCO (Millipore, Novagen) dialysis tubes was carried out at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... using 6–8 kDa MWCO (Millipore, Novagen) dialysis tubes was carried out at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1 mixture (Sigma-Aldrich, #D6421-6), Neurobasal medium (Life technologies #21103-049) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100mM PMSF (329-98-6; Sigma-Aldrich) in isopropanol (190764-4x4l ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Bioengineering 2022Quote: ... SLS-graft-PLGA (SLS-PLGA) was dissolved in ethyl acetate (EtOAc, organic phase) and calcium peroxide (CaO2, Cat# 466271, Sigma-Aldrich, St. Louis, MO, USA) and dissolved under stirring at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Cells were cultured in a 24-well plate (500’000 cells/well) in complete IMDM supplemented with 6 ng/ml IL-6 (Sigma), 6 ng/ml IL-3 (eBioscience ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatants were incubated with 6 µl anti-HA (12CA5, in-house preparation) or 6 µl anti-T7 (69522, Millipore) and protein G-dynabeads (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Loaded PDMS chambers were incubated for 30 minutes at 37°C and after polymerization muscle bundles were kept in normal proliferation medium containing 1.5 mg/ml 6-aminocaproic acid (6-ACA) (Sigma). After 2 days ...
-
bioRxiv - Neuroscience 2022Quote: Partial bilateral neostriatal dopamine lesions were made by injecting 6-OHDA (6 μg/μL, Sigma-Aldrich, St. Louis, MO) dissolved in ascorbic saline (de-ionized water containing 0.9% NaCl and 0.1% ascorbic acid ...
-
bioRxiv - Cell Biology 2022Quote: C57Bl/6 mice (6 weeks-old) were treated with an ip injection of 1500 mg TAA/kg (Sigma-Aldrich) to induce ALF ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-OHDA rats received 2.3 μL bilateral injections of 6-OHDA hydrobromide (6 μg combined with ascorbic acid dissolved in 2.3 μL sterile 0.9% NaCl, Sigma Aldrich) in the SNc in each cerebral hemisphere ...
-
bioRxiv - Developmental Biology 2023Quote: Pups were injected once daily intraperitoneally with 6-hydroxydopamine hydrochloride (6-OHDA) 50ug/g of body weight (Sigma H4381) from post-natal day 0 to 5 ...
-
bioRxiv - Neuroscience 2024Quote: ... each mouse received a bilateral injection of 1.25 μl of 6-hydroxydopamine hydrochloride (6-OHDA, Sigma-Aldrich, 4μg/μl) or vehicle (0.9 % NaCl + Ascorbic Acid 0.02% ...
-
bioRxiv - Immunology 2024Quote: ... BEAS-2B.MR1-GFP cells were incubated with 94 μM 6-formylpterin (6-FP, Schircks) or the equivalent volume of 0.01 M NaOH (Sigma) overnight at 37°C at 5e4/well in a 24-well plate ...
-
bioRxiv - Biophysics 2019Quote: ... 3 μL benzonase (Novagen) and sonicated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μM CHIR99021 (Sigma), 1 μM PD0325901 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % donkey serum (Millipore) and 0.5 % Triton X-100 in PBS at RT for 3 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3) Progesterone (Sigma P8783) – 0.02 µg/ml final concentration ...
-
bioRxiv - Developmental Biology 2021Quote: Nutlin-3 (Sigma, N6287) was dissolved in corn oil (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... 3% donkey serum (Millipore), and 0.2% Triton X-100 in PBS ...