Labshake search
Citations for Millipore Sigma :
9051 - 9100 of 10000+ citations for 5 Pyrimidinecarbonitrile 2 4 diamino 6 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... preceded by an Acsentis Express C18 2.7 µm guard column (5 x 2.1 mm guard (L × I.D. 5 mm × 2.1 mm, Millipore Sigma 53501-U). Flow rate was set to a constant rate 0.26 mL/min ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were dissolved in a liquid-crystalline medium composed by 5 % (w/v) mixture of 0.85 molar ratio of polyoxyethylene 5-lauryl ether (PEG/C12E5) (Sigma) and 1-hexanol (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed by centrifugation at 5 000 x g for 5 minutes then resuspended in 5 mM HEPES pH 7.2 with 10 mM NaN3 (Sigma) and depolarized at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO], Dispase 5 mg/mL [GIBCO], Y-27632 10.5 μM [Sigma] ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’- GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’- AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2024Quote: Huh7 cells (5 x 104 cells) were treated with 5 μg/ml of actinomycin D in DMSO (Sigma-Aldrich). Samples were harvested at the indicated times for total RNA extraction using the NucleoSpin RNA kit (Macherey Nagel ...
-
bioRxiv - Microbiology 2024Quote: ... a 1 μl bait inoculum was spotted on an approximately 5 mm x 5 mm sterile 0.22 μm pore size nitrocellulose membrane (Millipore) positioned at the usual bait inoculation location ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed and resuspended in lysis buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.1% NP-40, 1 mM PMSF, 1× yeast protease inhibitor cocktail [Sigma]). Cells were lysed by using a bead beater (Biospec products ...
-
bioRxiv - Molecular Biology 2021Quote: Protein-G (Protein G Sepharose® 4 Fast, cat# GE17-0618-01) or Protein-A (ProteinA-Sepharose® 4, cat#P9424 Millipore) beads were washed twice with 1x PBS and twice with IP100 buffer (25 mM Tris-HCl 7.9 ...
-
bioRxiv - Neuroscience 2019Quote: ... before fixation with 4% paraformaldehyde/ 4% sucrose (v/v), and subsequently permeabilized (DPBS, 0.2% triton X-100 (Sigma-Aldrich #9002-93-1)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and was centrifuged twice at 300 g for 10 min at 4 °C in a Sigma 4-16KS centrifuge (Sigma Laboratory Centrifuges) to remove cells and the supernatant was stored at −80 °C until use.
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with 500nM 4-hydroxytamoxifen (4-OHT) for 72h in 5i+LIF (Supplementary Table1) with 100 μM apoptosis inhibitor Z-vad (Sigma-Aldrich®) and 50 μM of necroptosis inhibitor Necrostatin-1 (Sigma-Aldrich®) ...
-
bioRxiv - Neuroscience 2022Quote: ... and the cochleae were fixed in 4% paraformaldehyde (PFA) overnight at 4 °C and then decalcified in 10% EDTA (#798681, Sigma, Darmstadt, Germany) in PBS for 2–3 days at 4 °C ...
-
bioRxiv - Genomics 2019Quote: Cells were seeded at a density of 4 × 104 cells per well in laminin coated 4 well chamber slides (Millicell® EZ slide, Merck Millipore, PEZGS0816). Cells were washed in cold PBS and fixed using 4% paraformaldehyde (PFA) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Established cell lines were propagated in DMEM containing 10% FBS and maintained with 100nM of (Z)-4-hydroxytamoxifen (4-OHT) (Sigma-Aldrich H7904) and routinely evaluated for mycoplasma contamination ...
-
bioRxiv - Neuroscience 2019Quote: ... Specimens for histamine immunohistochemistry were prefixed overnight at 4°C in 4% N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDAC, Sigma–Aldrich E6383). Brains were washed six times for 15 minutes each in PBS and subsequently immersed in Poly-L-Lysin (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... three times for 30 minutes each at room temperature and transferred into freshly made X-gal staining solution (4 mM potassium ferricyanide [Sigma-Aldrich, catalog no. P3667], 4 mM potassium ferrocyanide [Sigma-Aldrich, catalog no ...
-
bioRxiv - Neuroscience 2021Quote: ... and perfused with 40 ml of 0.1 M/L phosphate-buffered saline and 40 ml of 4% (w/v) PFA (Sigma, 30525-89-4) 24h after social interaction ...
-
bioRxiv - Cell Biology 2021Quote: ... diluted to an OD600 of 0.1 the next day and grown up to a mid-log phase (OD600 of 0.8) and labeled with 4-thiouracil (4-tU, Sigma, 2M in DMSO) for 6 min at a final concentration of 5 mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... cerevisiae was spiked with S. pombe total RNA (4:1 ratio S. cereviasiae : S. pombe)treated with 4-tU 500 μM final concentration (Sigma-Aldrich, 440736). The biotinylation was performed with 200ul EZ-link-HPDP-biotin (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3x with 1x PBS and incubated with appropriate primary antibody (Table 4) diluted in 4% BSA (Sigma, A9418-50G) in 1x PBS overnight at 4C ...
-
bioRxiv - Microbiology 2024Quote: ... the cells were washed with 500 μl of PBS and fixed with 500 μl of fixative solution (4% formaldehyde, Sigma, and 4% acrylamide, Sigma, in PBS) overnight (O/N ...
-
bioRxiv - Cell Biology 2023Quote: ... The organoids thus generated were re-plated at 1:4 split ratio and exposed to 400 nM 4-hydroxy tamoxifen (Sigma; Catalog #H7904) in medium to achieve the deletion of Cbl and Cblb ...
-
bioRxiv - Genomics 2023Quote: ... untethered Dam and Dam-Cbx1 constructs were fused to an ERT2 domain so that the fusion protein would be translocated to the nucleus upon 4-Hydroxytamoxifen addition (4-OHT, Sigma, Cat#SML1666) (Extended Data Table 1).
-
bioRxiv - Cell Biology 2023Quote: ... Enucleated eyes were immersion fixed in 4% PFA diluted in 1x PBS for 1h at RT and incubated in a hydrogel solution: 4% acrylamide (Sigma, Cat# A4058), 2% bis-acrylamide (Alfa Aesar Cat# J63265) ...
-
bioRxiv - Physiology 2022Quote: ... 2-bromopalmitate (2-BP) was delivered with fatty acid-free bovine serum albumin (Sigma-Aldrich, A6003) at a stock concentration 1 mM albumin with 5 mM 2-BP ...
-
bioRxiv - Cell Biology 2019Quote: ... the cell pellet was resuspended in 2 ml of 2 mg/ml collagenase IA (Sigma Aldrich) in PBS and incubated for 1 h at 37 °C on a horizontal shaker at 100 rpm ...
-
bioRxiv - Biochemistry 2020Quote: ... 2-acetazolamide and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Millipore-Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Immunology 2021Quote: ... Materials for interference testing included 2-phenoxyethanol (2-PE) (77699-250ML, Sigma-Aldrich, St Louis, MO), sodium citrate tribasic dihydroxide (C8532-100G ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 pmol (2 µL of stock) of the non-labelled AQUA® peptide HLEAAKGYSFTTTAEKAAELHK (Sigma-Aldrich) containing the quantification tag sequence GYSFTTTAEK was added to enable quantification of SIL-protein stock concentrations using MS analysis based on the ratio of heavy-to-light GYSFTTTAEK signals (see below) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial Glycerol Stock Sequence (same as Construct 2) 2# CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG) constructs were purchased from Sigma Aldrich. The plasmids were packaged into Lentiviral particles using the 2rd generation packaging plasmid (Addgene) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected approximately 2 μL of DNA (2 μg/μL) mixed with 0.1% Fast Green (Sigma) in PBS into a lateral ventricle of the embryonic brain with a pulled glass micropipette ...
-
bioRxiv - Plant Biology 2019Quote: ... resuspended in 2 ml of BY-2 medium supplemented with 150 µM acetosyringone (D134406, Sigma-Aldrich) and incubated at 28°C ...
-
bioRxiv - Biophysics 2019Quote: HUVECs were purchased from Lonza and cultured in Endothelial Cell Basal Medium (EBM-2) supplemented with 2% fetal calf serum (Sigma) and the following growth factors ...
-
bioRxiv - Biochemistry 2019Quote: ... resuspended at 2 × 107 / ml and incubated with 2 µg / ml anti BrdU antibodies (Sigma B8434) for 2 hrs at RT ...
-
bioRxiv - Bioengineering 2019Quote: ... HDI crosslinker (#52649) and 2-(trifluoromethyl)phenyl isocyanate (2-TPI) (#159379) were purchased from Sigma Aldrich. N,N-dimethylformamide (DMF ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 2 dpf in egg water with 0.003% 1-Phenyl-2-thiourea (PTU; Sigma, Cat#P7629) to suppress pigmentation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein sample (400 μg) was reduced by adding 2 μl of Tris(2-carboxyethyl)phosphine (Sigma) and incubating samples at 60 °C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... 2-hydroxyibuprofen (2-OH-IBU) and carboxyibuprofen (CBX-IBU) were obtained from Sigma-Aldrich (Steinheim, Germany). All chemicals and solvents used were of the highest purity available.
-
bioRxiv - Neuroscience 2022Quote: ... The retinas were dissected and embedded in 2% low melting agar (2-hydroxymethyl agarose, Sigma Aldrich), mounted on a vibratome (DSK Microslicer ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 2 buffer with 25% w/v (2-hydroxypropyl)-β-cyclodextrin (HP-β-CD, Sigma-Aldrich). Treatments were aliquoted into single and combined daily doses and frozen at -80 ºC ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were incubated for 2 hours at room temperature with 2% normal donkey serum (Sigma, G6767) in PBS overnight at 4 °C with c-Fos primary antibodies (226003 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was applied on an already equilibrated 2-(2-pyridyl)ethyl columns (Sigma 54127-U) with 1 ml of 50% MeOH with 2% acetic acid ...
-
bioRxiv - Plant Biology 2023Quote: ... 2% ß-mercaptoethanol and 2 tablets/10ml of complete EDTA free protease inhibitor (Sigma Aldrich, USA), 100μM E-64 cysteine protease inhibitor (Bera et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then fixed with 4% PFA (SIGMA #16005) for 15min at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were pre-treated with 4 µM heparin (Sigma) before adding α-Syn PFF.
-
bioRxiv - Cell Biology 2020Quote: ... with or without ATP (4 mM, pH 8.0, Sigma) and incubated in a thermoshaker (15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were mounted in MOWIOL 4-88 (Merck-Millipore). All steps were conducted at room temperature and in the dark post-secondary antibody addition ...