Labshake search
Citations for Millipore Sigma :
851 - 900 of 10000+ citations for Mouse Relaxin 3 RLN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... mounted in 3% methylcellulose (M0387, Sigma), and observed under a BX51 transparent light microscope (Olympus ...
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...
-
bioRxiv - Genetics 2024Quote: ... and 3 µM IWR1-endo (Millipore). Media was supplemented with 20 µM Y-27632 for the first week ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-aminotrizole (3-AT) (A8056, Sigma).
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM CHR99021 (SML1046, Sigma, USA), 10% KSR ...
-
bioRxiv - Immunology 2024Quote: ... 5uM MB-3 (Sigma-Aldrich, #M2449), and 5uM MG149 (Medchem Express ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Immunology 2021Quote: ... Cy3-STxB was generated by conjugating Cy3 dye onto STxB according to the manufacture manual of CY®3 Ab Kit (PA330000, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2022Quote: For RNA-binding protein immunoprecipitation (RIP) ~3×107 A549 cells for each sample were processed using Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore Sigma) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were transfected with a 1:3 molar ratio of heavy chain and light chain expression vectors using the Expi293 Transfection kit (Sigma-Aldrich; L3287) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... the cells were lysed and the ATP content was measured by an ATP assay kit per manufacturer’s instruction (Millipore Sigma, n = 3).
-
bioRxiv - Cell Biology 2020Quote: ... in serum was analyzed by measuring 3-hydroxybutyric acid (BOH) and acetoacetic acid (AcAc) using Ketone body assay kit (Sigma, No. MAK134) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... The a-P28 antibody was conjugated with the Cy3 fluorescent dye using the Cy®3 Ab Kit GE Healthcare (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: The G3P concentration was quantified using the Glycerol-3-Phosphate Assay Kit (MAK207) according to the technical bulletin (Sigma-Aldrich, United States). The concentration of G3P was expressed in ng/μg protein.
-
bioRxiv - Cancer Biology 2021Quote: ATP levels were measured in control and constricted breast cancer cells (3 x 105 cells) using the ATP fluorometric assay kit (Sigma-Aldrich, MAK190), following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 3 and 7 post-drug or vehicle administration were analyzed to quantify urea levels with a urea assay kit (Sigma-Aldrich, MAK006) according to vendor-provided protocol ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... viability measurements were performed for the 1 vpc and 3 vpc conditions of all vectors and two wells of uninfected cells with the Cell Counting Kit 8 (CCK8, Sigma-Aldrich #96992). Subsequently ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mg/mL mouse anti-Myc (EMD Millipore, 4A6 [mouse]), 1 mg/mL rabbit anti-Myc (EMD Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti mouse Nestin (Millipore, product no: MAB353, (1:100)) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-γ tubulin and mouse anti-a tubulin (Sigma). Goat anti-mouse IRDye 680RD and goat anti-rabbit IRDye 800CW (LI-COR Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg of protein from each sample were incubated with 3 ug of HOXA9 (Millipore # 07-178) or Rabbit IgG Isotype control (Invitrogen # 02-6102 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Cell Biology 2020Quote: ... blocking was performed in 3% BSA in PEM80 for 45 minutes and incubated overnight with a primary antibody against αTub (mouse IgG1, Sigma Aldrich, B-5-1-2, dilution 1:500). The cells were again washed with PBS (3×5 min ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were fixed with 3.7% paraformaldehyde and washed 3 times with PBS before and after incubation with mouse anti-FLAG M2 primary antibody (Sigma, diluted 1:2000 in PBS with 1% BSA) or HRP-conjugated anti-mouse IgG secondary antibody (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-mouse (Sigma), 1:10,000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse IgG (Sigma), and rat IgG (Sigma).
-
bioRxiv - Plant Biology 2020Quote: ... anti-mouse (Sigma) or anti-rabbit peroxidase-conjugated (Merck Millipore ...
-
bioRxiv - Neuroscience 2019Quote: ... Flag (Mouse, Sigma), vGLUT1 (Guinea Pig ...
-
bioRxiv - Microbiology 2019Quote: ... β-actin (mouse, Sigma), GAPDH (mouse ...
-
bioRxiv - Neuroscience 2019Quote: ... Flag(mouse, Sigma), GST(rabbit ...
-
bioRxiv - Neuroscience 2019Quote: ... GFAP(mouse, Sigma), PSD-95(guinea pig ...