Labshake search
Citations for Millipore Sigma :
851 - 900 of 3713 citations for IL 17RA Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Appropriate secondary antibodies (IgG-Fc Specific-Peroxidase) of mouse or rabbit origin (Sigma-Aldrich Inc.) were used ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% heat-inactivated fetal calf serum (FCS, Sigma-Aldrich, St. Louis, MO, USA) and 120 µg/ml gentamicin (Refobacin ...
-
bioRxiv - Cancer Biology 2022Quote: ... MDA-MB-231 and BrM cells were cultured in 10% (v/v) FCS (Sigma-Aldrich)-supplemented RPMI-1640 (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Genetics 2022Quote: ... Human Erythroleukemia (HEL) and human TF-1 cells were cultured in RPMI-1640 medium (Sigma Aldrich #R8758) supplemented with 10% Fetal Bovine Serum (Sigma Aldrich #F0926 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte- human fibrinogen mixture (Sigma-Aldrich). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte-human fibrinogen mixture (Sigma-Aldrich) and 2µL of the mixture is carefully pipetted into the microwell ...
-
bioRxiv - Immunology 2021Quote: ... the amplified IL-22 gene was cloned into a pET32a (+) vector (Novagen, USA) using two restriction sites as shown in Figure 1b ...
-
bioRxiv - Neuroscience 2019Quote: ... interleukin alpha (IL-1a) (3 ng/ml; Sigma-Aldrich; Cat. No. I3901-5UG) and complement component 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-acetylated α-tubulin (clone 6-11B-1, Sigma-Aldrich, St. Louis, IL), anti-β-tubulin (E7 ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... Stimulated cells were treated with 68.7 ng/mL (8000IU) IL-4 (Sigma-Aldrich) and 5 μg/mL anti-CD40 (BioXCell ...
-
bioRxiv - Immunology 2020Quote: ... IL-2 and methanol were all purchased from Sigma-Aldrich (St. Louis, MO). Poly(lactide-co-glycolide)-block-poly(ethylene glycol)-succinimidyl ester (PLGA-PEG-NHS ...
-
bioRxiv - Biochemistry 2021Quote: ... NTPs were from Chem-Impex International (Wood Dale, IL) and all other chemical reagents were from Sigma-Aldrich. The pH of Tris-HCl was adjusted at 23 °C.
-
bioRxiv - Bioengineering 2022Quote: ... in medium containing 50 ng/mL IL-6 (Peprotech),10 ng/mL IL-15 and 15 ng/mL interferon-α2B (Sigma-Aldrich).
-
bioRxiv - Immunology 2022Quote: ... IL-10 -/- mice were given streptomycin (5 g/L, Cat#S9137, Sigma-Aldrich) in the drinking water ad libitum for 24 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... HPAECs were treated with 1 ng/ml IL-1β (Millipore Sigma, Catalog# H6291) for 8 hours.
-
bioRxiv - Microbiology 2023Quote: ... Cytokines were detected from vitreous humor using commercial kits IL-1β (Sigma-Aldrich), TNFα (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293-T cells were transiently transfected with GFP-V5 or GREP1-V5 fusion proteins using OptiMem and Fugene HD (Sigma-Aldrich, St. Louis, MO). 72 hours after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Bioengineering 2019Quote: ... Lyophilized proteins were purchased: human serum albumin (HSA; from human plasma, ≤0.02% Fatty acids, Lot #SLBZ2785, Millipore Sigma) and fibrinogen (FBG ...
-
bioRxiv - Biochemistry 2021Quote: Lyophilized human haptoglobin phenotype 1-1 (Hp) and human α,β haemoglobin (Hb) were purchased from Sigma Aldrich. Deglycosylation enzyme PNgase F was from New England BioLabs Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... Injection capillaries (PIEZO 8-15-NS, Origio, Charlottesville, USA) were filled with Fluorinert (FC-770, Sigma) for proper Piezo pulse propagation ...
-
bioRxiv - Biochemistry 2022Quote: ... HMEC are maintained in 10% FCS/Pen-Strep MCDB media supplemented with 2mM L-Glutamine (Sigma), EGF (2ng/ml ...
-
bioRxiv - Genetics 2020Quote: ... supplemented with 10 % (w/v) fetal calf serum (FCS)(PAA) and 2 mM L-glutamine (Sigma) at 37 °C with 5 % CO2 and saturated humidity ...
-
bioRxiv - Bioengineering 2021Quote: ... Four different target Fc-proteins were used in this study: hIgG (Sigma-Aldrich, St. Louis, MO), plant-expressed rCMG2-Fc ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 10% fetal calf serum (FCS; PAA, Linz, Austria) and 2 mm glutamine (Sigma Aldrich). Cells were selected for acquired drug resistance over several months via exposure to increasing concentrations of oxaliplatin or BOLD-100/KP1339 followed by drug-free recovery phases ...
-
bioRxiv - Cell Biology 2021Quote: ... S2R+ Cells (2 × 105) were seeded in Schneider medium plus 10% FCS (Gibco 21720024, Sigma F9665) in a 24-well plate ...
-
bioRxiv - Immunology 2022Quote: ... in PBS and stored in washing buffer (PBS+5%FCS+0.2% Triton X-100 (Sigma-Aldrich)+0.01% Thimerosal (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteinase K activity was blocked by the addition of 20% foetal bovine serum (FCS) (F7524, Sigma) followed by rinsing in R16 medium ...
-
bioRxiv - Biochemistry 2020Quote: ... ScFv-hFc or IgG were detected using goat-anti-hIgG(Fc)-HRP (1:70000, A0170, Sigma). Titration assays were performed using 384 well microtiter plates (Costar ...
-
bioRxiv - Cell Biology 2021Quote: ... University of Utrecht) were maintained in DMEM supplemented with 10% fetal calf serum (FCS; Sigma A7906) and 100 U/ml Pen/100 μg/ml Strep (Gibco ...
-
bioRxiv - Developmental Biology 2020Quote: ... spinal cords were overlaid with 3ml of F12 medium supplemented with 10% FCS (F7524; Sigma-Aldrich), 1% Penicillin/Streptomycin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... diluted 1:1 000 with secondary antibody Anti-Mouse IgG (Fc specific) HRP (Sigma-Aldrich #A0168) diluted 1:5 000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... They were cultured in FC supplemented with 1 μg ml-1 heparin (Sigma-Aldrich H3149-25KU), and 25 ng ml-1 FGF4 (R&D Systems 7486-F4-025 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were intraperitoneally injected with 250 mg/kg 5-fluorocytosine (5-FC) (Sigma Aldrich, Cat: F71291G), and after 12 hours ...
-
bioRxiv - Microbiology 2023Quote: ... The infected cells were cultured in DMEM with 10% FCS and 2μg/ml of cycloheximide (Sigma) for 24h ...
-
bioRxiv - Immunology 2023Quote: ... The cell pellet was resuspended in RPMI medium (Capricorn, RPMI-STA) containing 10 % FCS (Sigma, F7524). Before expansion ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed and resuspended in RPMI 1640/FCS with 50 μM 2-mercaptoethanol (Sigma-Aldrich) at concentration of 106 cells/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10% FCS (Eurobio Scientific, CVFSVF00-01) and containing 1% penicillin-streptomycin (Sigma-Aldrich, P4333). All cells were grown in a humidified incubator at 37°C with 5% CO2.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were frozen in DMEM+FCS+Pen/Strep supplemented with 20% FICOL-PM400 (Sigma, F4375-25G) as a cryoprotectant ...
-
bioRxiv - Cell Biology 2023Quote: ... FC and DN ARF6 for 24 hours were lysed in RIPA buffer (EMD Millipore, 20-188) containing protease inhibitors ...
-
bioRxiv - Cell Biology 2023Quote: ... Secreted JAGGED1-Fc was recovered from the culture media on Protein A agarose (Millipore, 16-125) and eluted with 100 mM glycine ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 10% FCS/PBS and fixed either with 1% PFA (Sigma-Aldrich #252549) for ChIP-seq or with 2% PFA for C-HiC for 10 minutes rolling ...
-
bioRxiv - Biophysics 2021Quote: PAI-1 (human recombinant, Sigma-Aldrich, Germany)
-
bioRxiv - Biophysics 2021Quote: Fibrinogen (human plasma purified protein, Sigma-Aldrich)
-
bioRxiv - Biophysics 2021Quote: ... PAI-1 (human recombinant, Sigma-Aldrich, Germany), Plasminogen (human plasma purified protein ...