Labshake search
Citations for Millipore Sigma :
801 - 850 of 10000+ citations for CTLA 4 Human HEK293 GST since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Bioengineering 2019Quote: ... Lyophilized proteins were purchased: human serum albumin (HSA; from human plasma, ≤0.02% Fatty acids, Lot #SLBZ2785, Millipore Sigma) and fibrinogen (FBG ...
-
bioRxiv - Biochemistry 2021Quote: Lyophilized human haptoglobin phenotype 1-1 (Hp) and human α,β haemoglobin (Hb) were purchased from Sigma Aldrich. Deglycosylation enzyme PNgase F was from New England BioLabs Inc ...
-
bioRxiv - Developmental Biology 2021Quote: Fish with mutations and transgenic background at 3.2 or 4 dpf were fixed 1 to 2 days at 4℃ with 4% paraformaldehyde (Sigma, P6148) in PBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Villin-CreERT2 duodenum (n=4 per genotype) were treated two days after seeding with 4-hydroxytamoxifen (4-OHT; Sigma-Aldrich) 1.25 µM for 15h ...
-
bioRxiv - Cancer Biology 2019Quote: ... MEFs were treated with 4-hydroxy-tamoxifen (4-OHT; 1μM, Sigma H6278). Mice were injected intraperitoneally with Tamoxifen (1 mg dissolved in corn oil ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed overnight in 4% formaldehyde and 4% acrylamide (Sigma, A8887) in PBS at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... and MEF cells fixed with 4°C 4% formaldehyde (Sigma-Aldrich, 252549) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: The cells were fixed with 4% paraformaldehyde/4% sucrose(v/v)(Sigma) in PBS for 15min at room temperature (RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were fixed overnight at 4°C in 4%PFA-MFSW (Millipore-Filtered Seawater buffer containing 4% paraformaldehyde) ...
-
bioRxiv - Biophysics 2019Quote: ... and fixated using 4% paraformaldehyde (PFA) (Sigma Aldrich, CAS 30525-89-4) for 1 hour after letting the cells adhere for another 30 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were treated with either 1uM 4-hydroxytamoxifen (4-OHT; Sigma Aldrich) dissolved in 100% ethanol or a vehicle (1:2000 100% ethanol ...
-
bioRxiv - Immunology 2020Quote: ... injection of 80 microg/g of 4-hydroxytamoxifen (4-OHT; Sigma-Aldrich) 24 hours prior to sacrifice ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Anhydrotetracycline (aTc) and 4-hydroxytamoxifen (4-HT) were purchased from Sigma-Aldrich.
-
bioRxiv - Cancer Biology 2021Quote: ... 4-Phenylbutyric Acid (4-PBA) and 2DG were obtained from Sigma Aldrich.
-
bioRxiv - Neuroscience 2021Quote: ... five-month old mice were injected with 4-hydroxytamoxifen (4-HT, Sigma) dissolved in sunflower seed oil (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... and inflated with 4% paraformaldehyde (PFA, CAS: 30520-89-4, Sigma-Aldrich) at a pressure of 25 cm water ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were given 20 mg/kg 4-hydroxytamoxifen (4-TM) (Sigma H6278) through intraperitoneal (i.p. ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-Aminopuridine (4-AP) was purchased from Sigma Aldrich (St. Louis, MO).
-
bioRxiv - Neuroscience 2022Quote: ... 4 µM 5-Fluoro-20-deoxyuridine (FDU) and 4 µM Uridine (Sigma). On day 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... tamoxifen as (Z)-4-Hydroxytamoxifen (1uM, 4-OHT; Sigma-Aldrich; Cat# H7904), and Gleevec (Imatinib mesylate ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with 1 μM 4-hydroxy-tamoxifen (4-OHT; Sigma-Aldrich) and 1 μM Shield1 (Clontech lab ...
-
bioRxiv - Cell Biology 2023Quote: N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM, Sigma) was dissolved in DMSO at 4 mg/ml as stock solution and diluted 20 times using a buffer containing 25 mM HEPES ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were treated with 1uM 4-hydroxy-Tamoxifen (4-OHT, Sigma-Alderich)
-
bioRxiv - Neuroscience 2023Quote: ... followed by 30 ml of cold (4 °C) 4% paraformaldehyde (Sigma Aldrich) dissolved in 0.1 M phosphate buffer (pH = 7.4) ...
-
bioRxiv - Microbiology 2024Quote: ... 4-hydroxybenzophenone (4-HBP) (Cat. No. H20202, Sigma-Aldrich, St. Louis, MO), was added to each sample before extractions ...
-
bioRxiv - Biophysics 2024Quote: ... and 4-nintophenyl acetate (4-NA) was from Sigma (St Louis, MO). The 27-residue Z7 peptide with the WT sequence ...
-
bioRxiv - Biophysics 2021Quote: PAI-1 (human recombinant, Sigma-Aldrich, Germany)
-
bioRxiv - Biophysics 2021Quote: Fibrinogen (human plasma purified protein, Sigma-Aldrich)
-
bioRxiv - Biophysics 2021Quote: ... PAI-1 (human recombinant, Sigma-Aldrich, Germany), Plasminogen (human plasma purified protein ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant human thrombin (1 U/ml, Sigma) was added to the bottom of a 3.0 µm costar polycarbonate transwell membrane insert (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... sativa–derived recombinant human albumin (Sigma-Aldrich), and 213μg/ml L-ascorbic acid 2-phosphate (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... 10μM recombinant human Gastrin (Sigma-Aldrich G9145), 50ng/mL recombinant human HGF (Peprotech 100-39H) ...
-
bioRxiv - Cell Biology 2019Quote: Primary human osteoblasts were purchased from Sigma. Co-culture cells were titrated to determine the highest viable seeding density to allow continuous culture for the duration of the osteoclast differentiation assay ...
-
bioRxiv - Molecular Biology 2021Quote: ... 25 IU human chorionic gonadotropin (hCG, Sigma) was injected 76 h later (14:00 on day 4 of estrous cycle ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 nM human gastrin I (Sigma-Aldrich), 500 nM A 83-01 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... coated with human plasma fibronectin (Millipore Sigma) diluted to 100 μg/mL in PBS ...
-
bioRxiv - Bioengineering 2019Quote: ... Human B-lymphoid (Sigma-Aldrich, Buchs Switzerland), 293T Flp-in T-REX (Life Technologies ...
-
bioRxiv - Immunology 2019Quote: ... 10% human serum (Sigma, St. Louis, MO), 10% heat-inactivated fetal bovine serum ...
-
bioRxiv - Developmental Biology 2020Quote: ... and human chorionic gonadotropin (hCG) (Sigma Aldrich). Fertilized oocytes were then transferred into M2 medium (Millipore ...
-
bioRxiv - Bioengineering 2019Quote: ... human tenascin-C (Millipore Sigma, Catalog #CC065), and human plasma fibronectin (Millipore Sigma ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10.7 μg/mL recombinant human transferrin (Sigma), and 20μg/mL recombinant human insulin (Peprotech) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 µg/mL human transferrin (Sigma-Aldrich), 92 nM FeCl3 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant human insulin (hINS) powder (Sigma Aldrich) was dissolved in 20 mM HCl (pH 2) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human embryonic kidney (HEK) 293T cells (Sigma) were maintained in DMEM supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2020Quote: Human neuroblastoma SH-SY5Y cells (Sigma-Aldrich) were grown in a 1:1 mixture of minimal essential medium (HyClone ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Human Adipocyte Magnetic Bead Panel (Millipore), a Bio-Plex 200 plate reader and the Bio-Plex Manager 6.1 software (Bio-Rad Laboratories) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-human IgG-peroxidase (Sigma-Aldrich), and mouse monoclonal anti-NeuN (clone A60 ...
-
bioRxiv - Immunology 2020Quote: ... human fibrinogen (Sigma-Aldrich, St Louis, MO); CD11b-FITC ...