Labshake search
Citations for Millipore Sigma :
801 - 850 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and nFIREX were either starved in medium containing 0.2 % FCS for 24 hours or stimulated with 5 µM 4-Hydroxy-Tamoxifen (4OHT, Sigma Aldrich, H7904).
-
bioRxiv - Cell Biology 2024Quote: Intracellular ROS was measured in hMG exposed to 5 ng/mL NM for 24 hours using 2′,7′-Dichlorodihydrofluorescein diacetate (DCFH2-DA) probe (Sigma-Aldrich), which turns highly fluorescent upon oxidation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sph2-YM4271 cells were grown on synthetic dropout (SD)-His media supplemented with the inhibitor 3 mM 3-amino-1,2,4-triazole (3-AT; Sigma). All Y1H effector plasmids were separately transformed into the Sph2-YM4271 reporter strain and plated on SD/-Leu plates ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... gly-ol] enkephalin acetate (DAMGO) (Bachem and Sigma-Aldrich), etonitazene hydrochloride fentanyl citrate ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate-toluoidine were from Sigma-Aldrich, St ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Immunology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich). Air-dried plates were read ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... and next 3 chamber volumes of 5 mg/ml κ-casein (Sigma, C0406) dissolved in MRB80 ...
-
bioRxiv - Cell Biology 2024Quote: ... Treated films were immediately incubated in 5% (3-Aminopropyl)triethoxysilane (APTES, Sigma, 440140) in ethanol (dark ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate-toluoidine were from Sigma-Aldrich, St ...
-
bioRxiv - Neuroscience 2021Quote: tert-Butanol (tB) (Sigma-Aldrich 360538) was diluted with water to prepare gradient delipidation solutions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and tert-Amyl alcohol (Sigma, 152463) and the uterine horn was exposed surgically ...
-
bioRxiv - Cancer Biology 2020Quote: ... The antibody reaction was visualized with 3-3’ diaminobenzidine (Sigma, D8001) followed by counterstaining with hematoxylin ...
-
bioRxiv - Neuroscience 2022Quote: ... prior to being rinsed and reacted using 3-3’diaminobenzidine (Sigma) as chromagen ...
-
bioRxiv - Biochemistry 2021Quote: ... and 3’,3’c-di-AMP were purchased from Sigma-Aldrich, 2’,3’-cGAMP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimidehydrochloride (EDC) were procured from Sigma Aldrich, USA.
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT, Sigma). Selection plates were left for 8 days at 30°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate (CHAPS) (C3023; Sigma Aldrich), and sodium dodecyl sulfate (SDS ...
-
bioRxiv - Systems Biology 2024Quote: ... 5µM 6-bromoindirubicin-3-oxime / GSK-3 inhibitor (Sigma, 361550-1MG) and 100 µg/ml Primocin (InVivogen ...
-
bioRxiv - Systems Biology 2024Quote: ... or 3-bromopyruvate (3-BP; Sigma-Aldrich, St. Louis, MO; 16490) were added to their respective wells ...
-
bioRxiv - Biophysics 2024Quote: ... 15 mM 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (Millipore Sigma E6383), 5 mM N-hydroxysuccinimide (NHS ...
-
bioRxiv - Neuroscience 2024Quote: ... were used to calculate the amount of standard (30–70 µg) of 1-O- Heptadecyl-2-Acetyl-sn-Glycero-3-Phosphocholine (17:0 PC; Sigma-Aldrich cat# 850360P) previously diluted in 10 mL of chloroform was added as an internal standard prior to extraction ...
-
bioRxiv - Neuroscience 2021Quote: ... CAS #75704-24-4) were bought from Sigma-Aldrich (St Louis, USA) on 2018 ...
-
bioRxiv - Neuroscience 2020Quote: ... we cryoprotected them for at least 24 hours in 30% sucrose (Sigma) in 1X PBS at 4°C before embedding them in Optimal Cutting Temperature (OCT ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated for 24 h with anti-GFAP (Mouse, 1:500, Sigma), anti-NeuN (Guinea Pig ...
-
bioRxiv - Molecular Biology 2021Quote: Cell migration assay was performed using 24 well chambers (Sigma CLS3422-48EA) with uncoated polycarbonate membranes (pore size 8µm) ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA isolation was performed using 25:24:1 phenol:chloroform:isoamyl alcohol (Sigma Aldrich) followed by ethanol precipitation of DNA for 1 hour at −20°C (Input DNA was isolated using the same procedure) ...
-
bioRxiv - Microbiology 2022Quote: ... and two rounds of extractions with Chloroform:Isoamyl Alcohol (24:1) (Sigma-Aldrich) to remove residual phenol before performing ethanol precipitation and wash (in 70% ethanol) ...
-
bioRxiv - Microbiology 2022Quote: ... followed by three rounds of Phenol:Chloroform:Isoamyl Alcohol (25:24:1) (Sigma-Aldrich) extraction using Qiagen MaXtract High Density tubes (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... the subjects self-administered 24 International Units (IU) of synthetic OXTint (Sigma-Tau Industrie Farmaceutiche Riunite S.p.A. ...
-
bioRxiv - Cell Biology 2022Quote: ... After 24 h,1 µM all-trans retinoic acid (RA)(Sigma #R2625) was added to fresh mTeSR1 media ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were activated for 24 hours by 100ng/mL LPS (Sigma Aldrich) and 50ng/mL IFNγ (R&D Systems ...