Labshake search
Citations for Millipore Sigma :
801 - 850 of 10000+ citations for 26S Proteasome Non ATPase Regulatory Subunit 11 PSMD11 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... cholera toxin B subunit (CtxB)-FITC conjugate (C1655), methyl-β-cyclodextrin (Mβ-CD, C4555) and chlorpromazine hydrochloride (CPZ, C8138) were procured from Sigma.
-
bioRxiv - Microbiology 2021Quote: ... Pre-cleared lysate was diluted to 500 μl with additional lysis buffer and incubated overnight with 40 μl Protein A agarose beads and 4 μg anti-FcRγ-subunit IgG (Millipore Sigma) at 4°C on a Labquake Rotator ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the incubation with fluorescein isothiocyanate (FITC)-cholera toxin B subunit (CTB; Sigma, C1655, 1: 1000 diluted in sterile PBS) for 1 hour at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were sedated with ketamine (10mg/kg) and Cholera Toxin subunit B (CT-B, 10 µl, Sigma C9903, 1% aqueous (sterile)) was injected subcutaneously into the distal and middle finger pads of digits 1-3 of both hands ...
-
bioRxiv - Neuroscience 2021Quote: ... We gently lowered a glass capillary (Φ = 8 μm opening) in the targeted regions and slowly injected about 30 nl cholera toxin B subunit (CTB, 1%, Sigma-Aldrich) or virus ...
-
bioRxiv - Neuroscience 2021Quote: The left caudate nucleus of one monkey (not included in the behavioral study) was infused with the retrograde tracer cholera toxin B subunit (C9903, Sigma-Aldrich) via guide cannulae ...
-
bioRxiv - Biochemistry 2023Quote: ... Fractions containing all 11 subunits were pooled and concentrated with an Amicon Ultra-15 Centrifugal Filter Unit with a 100 kDa cut-off (Millipore, UFC910024) and then loaded onto a 24 ml Superose 6 column equilibrated in CMG buffer/200 mM KCl ...
-
bioRxiv - Biochemistry 2023Quote: ... to 20 µl of 60S subunits (blasticidin S dataset) and 1 µl of 2 mM water-solubilised cycloheximide (Sigma-Aldrich 01810) to 20 µl of 60S subunits (cycloheximide dataset) ...
-
bioRxiv - Neuroscience 2020Quote: ... Unspecific antibody binding was prevented by incubating the blots in blocking solution containing 5% non-fat milk or 5% BSA (Sigma-Aldrich, St. Louis, MO, USA) in 1x Tris-buffered saline with 0.1 % Tween 20 (TBST ...
-
bioRxiv - Neuroscience 2021Quote: ... The blot was blocked in 5% non-fat milk in TBS-T and probed with primary antibodies mouse monoclonal anti-parvalbumin (Sigma-Aldrich Cat# P3088, 1:2000) and mouse monoclonal anti-β-actin (Sigma-Aldrich Cat# A5441 ...
-
bioRxiv - Immunology 2023Quote: ... The membranes were blocked with 5% (wt/vol) non-fat dry milk powder in TBS-T and probed with primary antibodies against the following targets: Flag (Sigma, F3165, 1:2000, mouse, monoclonal), anti-β-tubulin (Abcam ...
-
bioRxiv - Cancer Biology 2019Quote: ... MDA-MB-231 (HTB-26; ATCC) and MCF7 (HTB-22; ATCC) were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; D5796; Sigma Aldrich) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... PN19-26 control and TSA-treated retinal explant cultures were removed from membranes and incubated in trypsin (Sigma-Aldrich) solution for 20 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: (T-4)-[(1E,6E)-1,7-Bis[4-(dimethylamino)phenyl]-1,6-heptadiene-3’5-dionato-kO3’kO5] difluoroboron (CRANAD-2) [26] was purchased from Sigma-Aldrich AG ...
-
bioRxiv - Neuroscience 2019Quote: ... NaCl, 60; sucrose, 100; KCL, 2.5; NaH2PO4, 1.25; NaHCO3, 26; CaCl2, 1; MgCl2, 5; glucose, 20; from Sigma-Aldrich) and sliced to 300µm ...
-
bioRxiv - Neuroscience 2019Quote: ... They were then transferred to carbogenated ACSF without sucrose (NaCl, 125; KCL, 3.5; NaH2PO4, 1.25, NaHCO3, 26; CaCl2, 2; MgCl2, 2; glucose, 20; from Sigma-Aldrich) and were used for experiments after at least one hour ...
-
bioRxiv - Physiology 2020Quote: ... protease activation was examined in living cells upon an enzyme kinetic reaction up to 60min with 1μM Cholecystokinin (CCK, fragment 26-33; C-2175 Sigma) stimulation whereas necrosis was measured by propidium iodide exclusion (37) ...
-
bioRxiv - Neuroscience 2022Quote: ... 126 NaCl, 2.5 KCl, 1.25 NaH2PO4, 2 MgCl2, 2 CaCl2, 26 NaHCO3, and 10 glucose, 311 mOsm, Sigma-Aldrich) at 34°C for at least one hour before recording ...
-
bioRxiv - Genomics 2020Quote: Three primary female Smchd1GFP/GFP NSC lines were derived as previously described (26) and harvested with Accutase (Sigma-Aldrich), washed with culture medium and PBS and cross-linked with 1% formaldehyde (vol/vol ...
-
bioRxiv - Immunology 2020Quote: Yersinia pseudotuberculosis was grown overnight at 26°C on a 2xYT agar plate with 4mg/ml of irgasan (Sigma). 2xYT ingredients for 1 liter include ...
-
bioRxiv - Immunology 2019Quote: ... Blisters were pierced on their lateral border using a 26·5G needle and exudates collected into tubes containing 50μl 3% sodium citrate (Sigma) in PBS (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... using a mineralization solution with 10x SBF [26] and 100 μg/ml poly-aspartic acid (pAsp, P3418, Sigma-Aldrich). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... received a non-target shRNA viral injection (NT-shRNA; SHC016: MISSION® pLKO.1-puro non-Target shRNA Control Plasmid DNA; Sigma Aldrich, St. Louis, MA, USA) to determine any effects of surgery alone on respiratory behaviour ...
-
bioRxiv - Molecular Biology 2020Quote: ... L1 worms were isolated by filtration through an 11 µm nylon mesh filter (Millipore: S5EJ008M04). Approximately 100 L1 worms in M9 were dispensed to each well of a 96 well plate and an equal volume of potassium cyanide (KCN ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg/ml insulin (#I9278) and 2 × 10−11 M liothyronine (all Sigma-Aldrich, #T6397). HEK293T cells (a gift from Noor Gammoh ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sense and anti-sense Digoxigenin-11-UTP labeled probes (DIG RNA Labeling Mix, Sigma-Aldrich) were synthesized with SP6 and T7 RNA polymerases ...
-
bioRxiv - Biochemistry 2021Quote: ... K40: Acetylated lysine 40 of α-tubulin (Sigma Aldrich T7451 clone 6-11 B-1). Poly-Glu ...
-
bioRxiv - Cell Biology 2022Quote: We prepared 2% agarose gels with 0.5x TBE supplemented with 11 mM MgCl2 (Sigma-Aldrich) and 0.5 mg/ml ethidium bromide (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... NF-κB inhibitor Bay 11-7802 and JAK inhibitor 1 were both from EMD Millipore. PMA and Brefeldin A were purchased from Sigma and BioLegend ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antisense RNA probes were synthesized by in vitro transcription with either DIG-11-UTP (Sigma) or Fluorescein-12-UTP (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... In some experiments cells were incubated in the presence of BAY 11-7082 (Sigma, B5556).
-
bioRxiv - Neuroscience 2019Quote: ... 1% MEM non-essential amino acid solution (NEAA; Sigma-Aldrich #M7145), 10 ng/mL human recombinant BDNF (Promokine #C66212) ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 1x MEM Non-essential Amino Acid Solution (Sigma-Aldrich), 10 % v/v fetal bovine serum (FBS) ...
-
bioRxiv - Systems Biology 2020Quote: ... containing 1% non-autologous human plasma (Sigma-Aldrich, St Louis, USA), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... under non-reducing conditions and transferred onto PVDF membranes (Sigma Aldrich). After 1 hour blocking in 5% non-fat milk solution (Bio-Rad 170-6404 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% non-essential amino acids and 0.1 mM 2-mercaptoethanol (Sigma) for EB formation ...
-
bioRxiv - Microbiology 2022Quote: ... The following shRNAs were used: Non-Targeting Control shRNA (Sigma, SHC002), EIF4E2 shRNA#1 (sh4EHP#1 ...
-
bioRxiv - Biochemistry 2022Quote: ... were obtained from IDT and non-labelled template oligonucleotides from Sigma. The substrates were made by mixing equal amounts of primer and template oligos (300pM ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% MEM non-essential amino acid solution (NEAA; Sigma-Aldrich #M7145), 10 ng/mL human recombinant BDNF (Promokine #C66212) ...
-
bioRxiv - Cell Biology 2019Quote: ... Non-treated cells (vehicle only, containing 0.1% endotoxin free BSA, Sigma) served as controls for each experiment ...
-
bioRxiv - Cell Biology 2019Quote: ... or non-target controls (SHC202) (CCGGCAACAAGATGAAGAGCACCAACTC) and (TRCN0000158395; CCTACAGTGGATGTCCTACAT) (Sigma Aldrich). The transduced cells were selected in media containing 1 ug/ml puromycin for 6 days ...
-
bioRxiv - Bioengineering 2019Quote: ... antibiotics and 1% non-essential amino acids (all from Sigma-Aldrich). Fibroblasts grew from the fragments within 3-4 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were detached using non-enzymatic cell dissociation solution (Sigma Aldrich) when they reached 80 % confluence ...
-
bioRxiv - Neuroscience 2020Quote: ... A non-targeting shRNA (# SHC202) was also purchased from Sigma-Aldrich.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1.1 mM of MEM non-essential amino acid 100X (Sigma, USA), 1 ng/ml of ovine FSH (Sigma ...
-
bioRxiv - Bioengineering 2019Quote: ... 1% minimum essential medium non-essential amino acid solution (Sigma-Aldrich), 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Genetics 2020Quote: ... 0.1mM non-essential amino acids and 0.1mM 2-mercaptoethanol (Sigma-Aldrich), before being plated onto 0.1% gelatin-coated cover slips ...
-
bioRxiv - Cell Biology 2020Quote: ... The PVDF membrane was blocked with 5% non-fat milk (Sigma) in 1x PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% MEM Non-essential Amino Acid Solution (M7145, SAFC Sigma-Aldrich) and 200 μM L-ascorbic acid phosphate magnesium salt (013-19641 ...
-
bioRxiv - Cancer Biology 2020Quote: ... controls pLKO (SHC001, no insert) and non-mammalian shRNA (Sigma; SCH002) in 293T cells using the third-generation lentiviral packaging system (10,11) ...