Labshake search
Citations for Millipore Sigma :
751 - 800 of 7135 citations for Sheep Interleukin 6 IL6 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Chinese hamster ovary (CHO) cells (Sigma, passage 6 to 20) were chosen for this study due to the absence of endogenous ASIC-like currents [53] and were grown using standard procedures in the following medium ...
-
bioRxiv - Neuroscience 2019Quote: ... fructose-6-phosphate and other chemicals were from Sigma-Aldrich. ADP detection system (ADP-Glo ...
-
bioRxiv - Cell Biology 2020Quote: ... counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) for 5 min at room temperature and mounted with Fluoroshield™ (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Pathology 2020Quote: ... sodium phosphate (Sigma Aldrich, 7782-85-6, St. Louis, MO), sodium chloride (BDH ...
-
bioRxiv - Neuroscience 2019Quote: ... 250µL of 6% (w/v) carmine red dye (Sigma-Aldrich) in 0.5% (w/v ...
-
bioRxiv - Cancer Biology 2019Quote: 6-Diazo-5-oxo-L-norleucine (Don, D2141, Sigma, UK); Sodium dichloroacetate (DCA ...
-
bioRxiv - Neuroscience 2021Quote: ... and unilaterally injected with 6-OHDA (Sigma-Aldrich A/S) (2 µl of 7 µg/µl free base in saline containing 0.02% ascorbic acid ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 2 mg/mL 6-aminocaproic acid (ACA; Sigma). Tissues were maintained at 37 °C with 5 % CO2 ...
-
bioRxiv - Microbiology 2019Quote: ... secondary antibodies and 4′,6′-diamidino-2-phenylindole (DAPI; Sigma) for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... and supplemented with 6% inactivated fetal calf serum (iFCS, Sigma). The human macrophage-like cell line U937 (ATCC no ...
-
bioRxiv - Plant Biology 2020Quote: ... PGM buffer (6% mannitol, 3% sucrose, M5524 MS salts (Sigma), M7150 vitamins (Sigma) ...
-
bioRxiv - Immunology 2020Quote: ... 4 or 6 h with staurosporine (5 µg/ml, Sigma) at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... 0.5 μg/ml DAPI (4’,6-diamidino-2-phenylindole, Sigma) and images were acquired using a Zeiss LSM780 confocal laser scanning microscopy system and processed using the Zeiss Zen microscope and Axiovision 4.8 software.
-
bioRxiv - Developmental Biology 2019Quote: ... 2009.) and were resuspended in 6 M Guanidine HCl (Sigma cat# G3272-1KG ...
-
bioRxiv - Molecular Biology 2019Quote: 4’-6-Diamidino-2-phenylindole (DAPI) was purchased from Sigma Co. ...
-
bioRxiv - Genomics 2019Quote: ... One of these wells received 5 µM 6-TG (Sigma) in DMSO for negative selection and the other received DMSO as a control (mock selection) ...
-
bioRxiv - Genomics 2021Quote: ... containing 4 μl of 6 M Guanidine HCl (GuaHCl, Sigma) as lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Physiology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) was obtained from Sigma.
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used ...
-
bioRxiv - Microbiology 2021Quote: ... and 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) counterstain for 30 min in PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... the synthetic single-stranded oligonucleotides (Sigma-Aldrich, Supplementary Table 6) were diluted in sterile water to 200 nM ...
-
bioRxiv - Neuroscience 2021Quote: ... Where indicated 6-OHDA (2 μl; 0.5 gg/gl; Sigma) injections were performed in the same manner 0.4 mm rostral ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 6 mg/ml chicken egg white lysozyme (Sigma). Samples were incubated at 37°C for 30 minutes under shaking ...
-
bioRxiv - Cell Biology 2019Quote: ... or a cocktail of protease inhibitors: 6 µM Leupeptine (Sigma), 0.044 TUI/mL Aprotinine (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... PZ0233)– 10 μM in H2O (6) IRE1 inhibitor 4μ8c (Sigma, SML0949) – 64μM in DMSO (7 ...
-
A bacterial derived plant- mimicking cytokinin hormone regulates social behaviour in a rice pathogenbioRxiv - Microbiology 2021Quote: ... 6-(γ,γ-dimethylallylamino) purine (Sigma; Cat. No: D5912-5G) was used for calculation of standard curve.
-
bioRxiv - Genomics 2019Quote: ... 6 μg/mL methyl methanesulfonate (MMS, Sigma-Aldrich, MO, USA) or 12 μg/mL N-Nitroso-N-ethylurea (ENU ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1, Sigma; 1:2000), GFP (Abcam ab13970) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6 μM carbonyl-cyanide p-triflouromethoxyphenylhydrazone (FCCP) (Sigma-Aldrich C2920) and 4.5 μM Antimycin A (Sigma-Aldrich A8674) ...
-
bioRxiv - Bioengineering 2022Quote: ... the 6 wt.% gelatin solution (Porcine skin, Type A, Sigma) in deionized (DI ...
-
bioRxiv - Cell Biology 2022Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, Sigma 10 μg/ml) was used to stain cell nuclei ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500 microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Neuroscience 2022Quote: ... 10 μM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, Sigma) and 50 μM D ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Plant Biology 2022Quote: 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich, D9542)
-
bioRxiv - Neuroscience 2022Quote: ... 10 μM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, Sigma) and 50 μM D,L-2-amino-5-phosphonovaleric acid (AP5 ...
-
bioRxiv - Genetics 2022Quote: ... myoblasts were incubated with 6 μM of 5AzadC (Sigma, A3656) for 24h ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 days following induction cells were dissociated with Accumax (Millipore), collected and centrifuged ...
-
bioRxiv - Neuroscience 2023Quote: We used the dopamine toxin 6-hydroxydopamine-hydrobromide (Sigma, #162957) to ablate dopamine neurons in the hindbrain and striatum by injecting anesthetized tadpoles with ∼50 nl of OHDA or saline into target regions of each hemisphere using a Nanoject ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 treated with 10µM DMH4 (Sigma Aldrich, Cat D8696). Wildtype 2 includes 5 wild type embryos at 5 dpf and 5 wild type embryos at 3 dpf ...
-
bioRxiv - Biochemistry 2023Quote: ... 6’-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma, Cat# D9542-10mg) in PBS to stain cell nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) for nuclei counterstaining ...
-
bioRxiv - Neuroscience 2023Quote: ... We injected 6-OHDA-hydrobromide (4 mg/ml; Sigma-Aldrich) that was dissolved in saline containing 0.02% ascorbic acid into the right medial forebrain bundle at the coordinates 1.0-mm posterior ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Cell Biology 2023Quote: ... A solution of 6% carmine red (300 µl, Sigma, C1022) was prepared using 0.5% methylcellulose (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... 25 uL of (His)6-tagged TEV-protease (Sigma-Aldrich) was added and the solution incubated overnight at 4°C.
-
bioRxiv - Cell Biology 2023Quote: ... TA muscles were mounted on 6% tragacanth gum (Sigma, #G1128) and frozen in isopentane (Sigma ...