Labshake search
Citations for Millipore Sigma :
751 - 800 of 10000+ citations for Mouse Anti MERS Coronavirus Spike S1 Antibody 3873 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The secondary antibody used against anti-H3Pan was a rabbit anti-mouse IgG (Sigma, A9044) and the secondary antibody used against other primary antibodies was a goat anti-rabbit IgG (4052-05 ...
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies were rabbit anti-Iba1 (Wako) and mouse anti-α-tubulin (Sigma-Aldrich), used as a reference protein ...
-
bioRxiv - Neuroscience 2023Quote: ... Horseradish peroxidase (HRP) conjugated anti-rabbit and anti-mouse antibodies were obtained from Sigma Aldrich. L-Glutamate was also purchased from Sigma Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Appropriate secondary antibodies were used: phosphatase alkaline-conjugated goat anti-mouse or anti-rabbit (Sigma) along with the NBT and BCIP (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies for Western Blotting were anti-goat and anti-mouse-HRP coupled (Sigma-Aldrich) and for immunofluorescence were anti-rabbit-AF568 and anti-mouse-AF647 (ThermoFisher Scientific).
-
bioRxiv - Genomics 2022Quote: ... Infectious foci were stained with a human anti-SARS-CoV-2 Spike antibody (H2-162, Hugo Mouquet’s laboratory, Institut Pasteur) and the corresponding HRP-conjugated secondary antibody (Sigma-Aldrich). Foci were visualized by 3,3’-diaminobenzidine staining solution (DAB ...
-
bioRxiv - Cell Biology 2020Quote: ... with the appropriate secondary antibody (Anti-mouse IgG phosphatase conjugated antibody (Sigma-Aldrich Cat# A3688, RRID:AB_258106), or Anti-rabbit IgG phosphatase conjugated antibody (Sigma-Aldrich Cat# A3687 ...
-
bioRxiv - Cell Biology 2020Quote: ... and α-FLAG antibody (Monoclonal ANTI-FLAG® M2 antibody produced in mouse, Sigma Aldrich, #F3165). Per IP ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies used in this paper are mouse anti-CMV IE1/2 monoclonal antibody (MAB8131, Millipore), mouse anti-CMV pp52 monoclonal antibody (CH16 ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary and secondary antibody dilutions were as follows: mouse monoclonal anti-Lamp1 antibody 1:1000 (Sigma), rabbit polyclonal anti-MCT8 antibody 1:400 (Atlas antibodies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The primary antibody used was a mouse anti-FLAG M2 monoclonal antibody (1 : 2000, Sigma, F1804). The secondary antibodies used were Goat anti-Mouse IgG2b Cross-Adsorbed Secondary Antibody ...
-
bioRxiv - Neuroscience 2023Quote: The following primary antibodies were used: mouse anti-PCNA monoclonal antibody (Sigma P8825, 1:500 dilution), rabbit anti-GFAP (Dako Z0334 ...
-
bioRxiv - Neuroscience 2023Quote: ... We used the primary antibody of anti-PV mouse monoclonal antibody (1:1000, MAB1572, Merck Millipore) combined with the secondary antibody of anti-Mouse polyclonal goat antibody conjugated with Alexa Fluor 647 (1:1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... antibodies followed by an anti-mouse secondary antibody conjugated to alkaline phosphatase (AP) (A3562, SIGMA-Aldrich). We developed the immunoblots with BCIP/NBT color development substrate and normalized protein levels to Ponceau Red staining ...
-
bioRxiv - Developmental Biology 2023Quote: Primary antibodies used include mouse monoclonal ANTI-FLAG® M2 antibody (diluted 1:5000, F3165, Sigma), mouse anti-HA IgG monoclonal antibody (Krackler ...
-
bioRxiv - Biochemistry 2023Quote: ... before the secondary antibody was added (anti-mouse IgG-peroxidase antibody produced in goat, Sigma-Aldrich). The secondary antibody was diluted 1:50,000 in 5% skim milk solution in TBS-T and incubated for two hours at room temperature on a slow shaker ...
-
bioRxiv - Immunology 2023Quote: ... The protein antibody used for western blotting was mouse or rabbit anti-6xHis antibodies (Millipore-Sigma). Secondary antibodies were IRDye 680RD goat anti-mouse and/or IRDye 800CW goat anti-rabbit (Li-Cor) ...
-
bioRxiv - Immunology 2023Quote: ... The protein antibody used for western blotting was mouse or rabbit anti-6xHis antibodies (Millipore-Sigma). Secondary antibodies were IRDye 680RD goat anti-mouse and/or IRDye 800CW goat anti-rabbit (Li-Cor) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The following primary antibodies were used: mouse anti-Myc antibody clone 9E10 (13-2500 Sigma-Aldrich), rabbit polyclonal anti-Myc (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... with primary antibodies diluted in PBST using anti-acetylated tubulin antibody produced in mouse (Sigma-Aldrich) and a rhodamincoupled phalloidin (Abcam ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Biochemistry 2023Quote: ... The respective 97-mer oligonucleotides (Sigma Aldrich, for guide sequences see table 2) were amplified by PCR using the following conditions ...
-
bioRxiv - Immunology 2024Quote: ... then incubated with goat anti-mouse secondary HRP antibody (Sigma-Aldrich, #A0168, 1:10,000, for mouse plasma) or goat anti-human secondary HRP antibody (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in biotinylated goat anti-mouse secondary antibody (Sigma, B0529,1:200) for 1 hour ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cells were incubated with anti-GM130 antibody (clone 4A3 Millipore, Mouse), or calnexin (mouse mAb ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary antibodies used were mouse anti-α-SMA (clone 1A4, Sigma-Aldrich) 1:10 000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal ANTI-FLAG® M2 Antibody (Sigma-Aldrich, F1804, 1:4000), mouse monoclonal anti-HA-tag Antibody (Moravian ...
-
bioRxiv - Cell Biology 2020Quote: Antibody anti-acetylated tubulin (clone 6-11B-1, mouse monoclonal, Sigma Aldrich), anti-Poly-Glu tubulin (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... secondary antibody: anti-mouse-Alexa 594 at 1:1000 (Millipore Sigma, F0257). Images were taken at 100X magnification on Lionheart (Biotek).α-SMA area was analyzed using ImageJ (NIH) ...
-
bioRxiv - Immunology 2021Quote: ... followed by a mouse anti-rabbit Alexa Fluor 488 secondary antibody (Sigma) and Vybrant DyeCycleViolet Stain (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse anti-cadherin-11 (clone 16A) antibody was from Millipore (Billerica, MA). Mouse anti-cadherin-11 (clone 5B2H5) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse anti-acetylated-a-tubulin antibody (T7451, 1:1000 dilution, Sigma) were used for immunofluorescence ...
-
bioRxiv - Neuroscience 2022Quote: ... or mouse anti-TPH2 primary antibody (1:100 dilution, T0678, Sigma-Aldrich). The secondary antibodies used were donkey anti-mouse Alexa 488 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were stained with primary mouse antibodies anti-FLAG M2 (Sigma, F1804) or anti-dsRNA J2 (Jena Bioscience ...
-
bioRxiv - Biochemistry 2022Quote: ... Membranes were incubated with primary antibody (mouse anti-FLAG M2, Sigma F1804) at 1:1000 dilutions in 3% milk-TBS-T overnight rotating at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies assessed include mouse anti-ATXN3 (1H9) (1:500; MAB5360; Millipore) and rabbit anti-Olig2 (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... with a monoclonal anti-NeuN antibody (1:500; Mouse, MAB377, Merck Millipore) for brain sections in 0.5x blocking buffer supplemented with 0.5% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were incubated with anti-Flag M2 mouse monoclonal antibody (Sigma-Aldrich) diluted 1:400 in blocking solution for 1 h to detect SRVB/A reporters ...
-
bioRxiv - Molecular Biology 2021Quote: ... Membranes were incubated overnight with mouse anti-GFP primary antibody (Sigma-Aldrich) used at 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2021Quote: ... monoclonal mouse anti-FLAG antibody was from Sigma (clone M2, Cat#F1804), mouse anti-GFP was from Roche (Cat# 11814460001) ...
-
bioRxiv - Immunology 2022Quote: ... as primary antibody and goat anti-mouse IgG whole molecule (Sigma # A4416) as secondary antibody.
-
bioRxiv - Microbiology 2020Quote: ... 35 μl monoclonal anti-FLAG M2 antibody produced in mouse (Sigma-Aldrich) was added to the supernatant and incubated for 30 min at 4 °C ...
-
bioRxiv - Genomics 2020Quote: ... We incubated the membrane in Anti-FLAG mouse monoclonal Antibody (Sigma, F3166) and V5 rabbit polyclonal antibody (Santa Cruz ...
-
bioRxiv - Biochemistry 2019Quote: ... followed by incubation with mouse monoclonal anti-myc antibody (RRID: AB_309938, Millipore) at a 1:2,000 dilution in TBS and 3% (w/v ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Commercial available antibodies are mouse anti-Flag (1:1000, Sigma, M2, F3165), and mouse anti-α-tubulin (1:150 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies were detected by Texas Red-conjugated goat-anti mouse (Sigma) or FITC-conjugated goat anti-rabbit (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... before adding secondary antibody (peroxidase-conjugated anti-mouse IgG [A9044, Sigma-Aldrich]) diluted 1:2000 in ELISA III buffer for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse monoclonal anti-γH2AX antibody (IgG1) is from clone JBW301 (Millipore) and the mouse monoclonal anti-ß-Tubulin III (IgG2A ...
-
bioRxiv - Cell Biology 2019Quote: ... The primary antibodies used were mouse anti-Flag (1:1,000, Sigma-Aldrich), rabbit anti-Flag (1:1,000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... then incubated with primary antibodies (mouse anti-PAR, 1:400 Merck Millipore Cat#AM80 RRID ...