Labshake search
Citations for Millipore Sigma :
751 - 800 of 10000+ citations for MBL 2 MBP C Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Concentrations of 29 cytokines/chemokines were measured in 2-4 biological replicates using MILLIPLEX Map Human Cytokine/Chemokine Magnetic Bead Panel (HCYTMAG-60K-PX29, #Millipore) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Samples were then diluted 1:2 in serum matrix for analysis with Milliplex Non-Human Primate Magnetic Bead Panel as per manufacturer’s instructions (Millipore Corporation). Concentrations for each cytokine were determined for all samples using the Bio-Plex 200 system (BioRad Laboratories Inc.).
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... All single-cell samples were distributed at 0.5×106 cells/mL for live staining with monoclonal mouse anti-human FOLR1 IgG1 (LS Bio) in DPBS with 2% v/v FBS (Sigma). Secondary staining for target was performed using QIFIKIT® (BIOCYTEX ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma, supplemented with 27mM sodium biocarbonate ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... The infectious blood meal consisted of a 2:1 mix of washed human erythrocytes and viral suspension supplemented with 10 mM ATP (Sigma). The infectious titers were 107 FFU/mL for DENV-1 ...
-
bioRxiv - Immunology 2022Quote: ... expanded in the presence of recombinant human IL-2 (1000 U/mL, Proleukin) and rapamycin (50 nmol/L, Sigma-Aldrich), and transduced after 2 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 (human retinal pigment epithelial) cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Immunology 2022Quote: ... in mid-logarithmic phase was added at a multiplicity of infection of 2 in RPMI with 10% human serum (Sigma). Bacteria were spun down for 5 min at 800 x g and incubated for 1 h at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Human PBMC were pre-activated with 30 ng/ml anti-CD3 (OKT3, Miltenyi) and 50 IU/ml IL-2 (Sigma) and subsequently transduced two times with viral supernatant in the presence of 6 ug/ml polybrene (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: The transfected HEK293 cells were seeded on glass coverslips (Matsunami) coated with poly-L-lysine solution (Sigma-Aldrich) then incubated for 4–10 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... Neuro-2a (N2a) and HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose (Sigma-Aldrich) supplemented with 10% (v/v ...
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 cell viability after iOn plasmids transfection was assessed by dye exclusion with Trypan blue solution (0.4%, Sigma). FP expression was either assayed by flow cytometry ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T and HEK293-FT cells were maintained in DMEM supplemented with 10% FBS,1 mM sodium pyruvate (Sigma), 2 mM L-glutamine (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: HEK293-FLP cells stably expressing UBC:DOR-APEX2 were plated onto poly-L-lysine (Sigma Aldrich, Cat # P8920-100ML) coated coverslips in wells of a 24-well plates ...
-
bioRxiv - Microbiology 2023Quote: HeLa cells and HEK293 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum (Sigma) at 37°C in 5% (V/V ...
-
bioRxiv - Biochemistry 2021Quote: ... and purified using DDDDK-tagged protein purification gel (MBL, Japan) followed by elution with 0.1 mg/ml FLAG Peptide (Sigma-Aldrich Co., St. Louis, Missouri, the US). To remove the flag peptide ...
-
bioRxiv - Bioengineering 2019Quote: ... 100 µg/ml human recombinant Delta-1 or human IgG (Sigma) was added ...
-
bioRxiv - Immunology 2023Quote: ... Anti-human IgG HRP antibody (Anti-Human IgG-Peroxidase from Sigma) was diluted 1:30,000 in blocking buffer ...
-
bioRxiv - Genomics 2021Quote: ... RNA/DNA was precipitated by incubation at −80°C for 2 hrs with 600 μl cold ethanol (Sigma-Aldrich, cat.no ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1/1000) antibodies for 2 h at 37 °C in antibody diluent solution (Duolink in situ kit, Sigma-Aldrich). The cells were then labeled with the PLA antimouse PLUS probe (DUO92001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... then 10min at 4°C in the Lysis buffer 2 (50mM Tris pH8, 10mM EDTA, 0.5% NP-40, Complete protease inhibitor (Sigma)) and subsequently sonicated in 15ml conical tubes with a Bioruptor Pico (Diagenode ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1 mM DTT) for 2 hours at 30°C with native Tobacco Etch Virus (TEV) protease (Sigma-Aldrich). The purified recombinant proteins were concentrated using Amicon centrifugal filters following the manufacturer recommendations (Millipore) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue was digested for 1 hour at 37°C in 2 mg/mL of Pronase Protease (Millipore, Temecula, CA) in growth media containing 1mM L-glutamine ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell lysates were cleared by centrifugation and incubated at 4°C for 1.5–2 h with anti-FLAG M2 affinity gel (Sigma). After extensive washing with native IP buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Primary acinar cells were pelleted (80 g, 2 min, at 4 °C) and re-suspended in Waymouth media (Sigma). To obtain acinar-cell-conditioned media ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 2 hours at 37°C that had been stripped twice with 0.5 g activated charcoal (Sigma-Aldrich, C9157) per 10 mL serum ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were cleared by centrifugation at 16,000 xg at 4°C for 2 min and Pah1-FLAG was immunoprecipitated with anti-FLAG agarose beads (Sigma) at 4°C for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates were incubated for 2 h on a rotating wheel at 4°C with anti-FLAG M2 beads (Sigma). Beads were washed once with lysis buffer (without benzonase ...
-
bioRxiv - Cell Biology 2021Quote: African green monkey kidney Vero E6 cell and Colorectal Adenocarcinoma human epithelial (Caco-2) cells were maintained at 37 °C in 5% CO2 in Dulbecco’s minimal essential medium (DMEM) (Sigma) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated for 2 days at 4°C in goat anti-calretinin (1:200; Cat#AB1550, EMD Millipore), followed by 2.5 hours incubation (RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubes were kept at 37°C in a heating block (DB200/2; Techne) and D-biotin (B4501; Sigma-Aldrich) at a final concentration of 500 μm was added at each time point (for the majority of experiments 35 min) ...
-
bioRxiv - Cell Biology 2019Quote: ... were fully digested for 2 days at 4 °C in 0.1M of HCl digestion solution containing 1 mg/ml pepsin (Sigma). Collagen content was measured using the Sircol collagen assay kit (Biocolor) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100mM NaHCO3) and crosslinks reversed overnight at 65°C with 200 mM NaCl and 2 μl RNase A (Sigma). A matched input sample (corresponding to 10% of original ChIP reaction ...
-
bioRxiv - Developmental Biology 2019Quote: ... All animals were incubated at 28.5°C for 24h before treatment with 1-phenyl-2-thiourea (PTU) (Sigma Aldrich) to prevent pigment formation.
-
bioRxiv - Cell Biology 2023Quote: ... 1 3 v/v) at 80°C for 2 h after addition of 50 nmol 5α-Cholestane (Sigma, C8003) as internal standard for neutral sterol analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... it was baked at 150°C for 2 hours and coated with gas-phase trichloro(perfluorooctyl)silane (Sigma-Aldrich). A negative mold of the silicon wafer was created using PDMS and treated with silane in the same way as the wafer ...
-
bioRxiv - Cell Biology 2023Quote: ... for 40 min at 37°C and then counterstained with 2 μg/mL propidium iodide (PI) (Sigma-Aldrich, P4170) for 5 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... digestion was performed at an enzyme:protein ratio of 1:100 for 2 hours at 25°C followed by trypsin (Sigma) digestion at an enzyme:protein ratio of 1:50 overnight at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... Serum and supernatant from homogenized tissues were incubated overnight at 4°C with 2% Trichloroacetic acid solution (Sigma, #T0699) at a 1:1 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then incubated for 2 hours at 35 °C with 5 μl of 500 mM CaCl2 (Sigma-Aldrich), 250 ng of competence stimulating peptide 1 (CSP-1 ...
-
bioRxiv - Genomics 2023Quote: ... was prepared in aliquots of 2 μl stored at -80°C and contained 0.04 μl 10% Triton X-100 (Sigma), 0.1 μl SUPERasin RNAse Inhibitor (20 U/μl ...
-
bioRxiv - Cell Biology 2023Quote: ... The equivalent of 2 OD595 was quenched by direct injection into 100% -80°C LCMS-grade methanol (Sigma Aldrich). Polar metabolite extraction was adapted from a protocol described in (Doppler et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and resuspended in 1-1.5 ml chilled wash and resuspension buffer containing 2% Bovine Serum Albumin (Sigma) and 0.2 U/μl RNase Inhibitor (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then incubated at 37°C under 5% CO2 in serum free DMEM containing 2% penicillin/streptomycin (Sigma) and 1 µg/ml TPCK Trypsin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then incubated at 37°C with 5% CO2 in serum free DMEM containing 2% penicillin/streptomycin (Sigma) and 1 µg/ml TPCK Trypsin (Sigma ...