Labshake search
Citations for Millipore Sigma :
751 - 800 of 10000+ citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and blocked for 5 min in PBS buffer containing 2% bovine serum albumin (BSA, Sigma). Incubation with primary antibodies in PBS buffer ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-α-tubulin (1:2,000; clone B-5-1-2, Sigma-Aldrich, cat. # T5168) and mouse anti-MIC2 (1:2500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5-Bromo-2′-deoxyuridine (10280879001) and D-Luciferin (L9504-5MG) was purchased from Sigma-Aldrich. All plasmids used in this study were listed in supplementary Table 1 and will be donated to Addgene.
-
bioRxiv - Pathology 2022Quote: ... 15-30 μg protein per sample were denatured with 5 % vol/vol 2-mercaptoethanol (Sigma) for 5 min at 95 °C before they were loaded in Bolt™ 4–12 % Bis-Tris gels (Thermo Fisher) ...
-
The cellular basis of protease activated receptor type 2 (PAR2) evoked mechanical and affective painbioRxiv - Neuroscience 2020Quote: ... and 3 ug/ml 5-fluoro-2’-deoxyuridine + 7 ug/ml uridine (FRD+U; Sigma) added ...
-
bioRxiv - Microbiology 2022Quote: ... all assays were scored after 6 days and included 5-fluoro-2’-deoxyuridine (FUdR; SIGMA) to prevent the appearance of the next generation of larvae that would complicate the experiments [55] ...
-
bioRxiv - Immunology 2022Quote: ... was modified with 5-Norbornene-2-acetic acid succinimidyl ester (Nb-NHS) (Sigma Aldrich #776173) using a ratio of 1g Nb-NHS ...
-
bioRxiv - Biophysics 2022Quote: ... followed by 2 h in 5 μg/mL laminin (Sigma-Aldrich, L2020, diluted in PBS). Following explant plating ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were sequentially labeled with 30 μM 5-iodo-2′-deoxyuridine (IdU) (Sigma-Aldrich) at 37°C for 4 h ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (cAMP; 50 μM, Millipore Sigma, D0627), and cis-4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Other reagents used in this study included 5-chloro-2’-deoxyuridine (CldU, Sigma-Aldrich C6891), 5-Iodo-2’-deoxyuridine (IdU ...
-
bioRxiv - Cell Biology 2024Quote: In-gel samples were reduced with 5 mM tris(2-carboxyethyl)phosphine (TCEP) (Sigma Aldrich), alkylated with 5 mM N-Ethylmaleimide (NEM) ...
-
bioRxiv - Neuroscience 2023Quote: Proliferating cells were labelled with the thymidine analogue 5-ethynyl-2’-deoxyuridine (EdU) (Sigma; 900584) at a dose of 50 mg/kg body weight in vivo or 1 μM in vitro ...
-
bioRxiv - Pathology 2023Quote: ... and then with 5% goat serum and 2% BSA (Sigma-Aldrich, St. Louis, MA, USA). Staining was performed using the VECTASTAIN Elite ABC HRP kit (PK-6200 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 μg/mL + 7 μg/mL FRD+U (5-Fluoro-2′-deoxyuridine, Sigma-Aldrich, Cat# F0503 and Uridine ...
-
bioRxiv - Immunology 2023Quote: Islet MTs were treated with IL-1β (2, 5 or 10 ng/mL, Sigma-Aldrich), IFNγ (10 ...
-
bioRxiv - Neuroscience 2023Quote: ... (D-Ala(2)-mephe(4)-gly-ol(5))enkephalin (DAMGO, Sigma-Aldrich, Cat. No. E7384) at 50 µM or lipopolysaccharide (LPS ...
-
bioRxiv - Physiology 2023Quote: ... 15-35 µg protein per sample were denatured with 5 % v/v 2-mercaptoethanol (Sigma) in LDS sample buffer (Thermo ...
-
bioRxiv - Systems Biology 2023Quote: ... tissue sections were deparaffinized by washing 2×5 minutes in Neo Clear (Sigma Aldrich, 1.09483.5000), followed by a series of 99% ...
-
bioRxiv - Neuroscience 2023Quote: ... uridine and 5-Fluoro-2’-deoxyuridine were purchased from Sigma-Aldrich (St. Louis, MO, USA); D-APV (D-(-)-2-Amino-5-phosphonopentanoic acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... hESCs medium with 25 μM 5-chloro-2′-deoxyuridine (CldU; Sigma-Aldrich, St. Louis, MO) was added to the cultures ...
-
bioRxiv - Microbiology 2023Quote: ... Parasites were incubated with 100 μM of 5-bromo-2-Deoxyuridine (BrdU, Sigma Aldrich B5002) for 1 hour at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... After 2 days incubating with 5 μM ROCK Inhibitor (Y-27632, RI, from Merck Millipore), 40 μM TGF-β inhibitor (SB 431524 ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Sigma-Aldrich 68957) and alkylated with 10 mM chloroacetamide (Sigma-Aldrich 22790) ...
-
bioRxiv - Cell Biology 2024Quote: ... Senescence was induced by treating HeLa cells with 200μM 5-Bromo-2’-deoxyuridine (BrdU, Sigma) freshly prepared in DMSO or exposing the cells to ionizing radiation (8 Gy ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by a second labelling with 200 mM 5-iodo-2-deoxyuridine (IdU, Sigma-Aldrich). For HU treatment ...
-
bioRxiv - Molecular Biology 2024Quote: ... pH 8.5 and reduced with 5 mM Tris(2-carboxyethyl)phosphine hydrochloride (Sigma-Aldrich, C4706) and alkylated with 55 mM 2-Chloroacetamide (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... a mix of 37 mM uridine and 27 mM 5-fluoro-2-deoxyuridine (Sigma Aldrich) was added to the cultures.
-
bioRxiv - Cell Biology 2024Quote: ... and freshly added 10 mM ROCK inhibitor and 2 mg/ml Doxycycline (Sigma, D9891-5) to initiate differentiation ...
-
bioRxiv - Neuroscience 2024Quote: Proliferating cells were labelled with the thymidine analogue 5-ethynyl-2′-deoxyuridine (EdU) (Sigma; 900584) at a 1 µM concentration that was added to the culture media 1 h before fixation ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM sodium ascorbate) on ice and filtered through 2 layers of Miracloth (Merck Millipore). Intact chloroplasts were collected from a band at the interface between the 40 % (v/v ...
-
Hepatic iNKT cells facilitate colorectal cancer metastasis by inducing a fibrotic niche in the liverbioRxiv - Immunology 2024Quote: ... Sections were washed 2 times for 5 minutes in 0.5% glacial acetic acid (Sigma-Aldrich). Tissue sections were dehydrated through an ethanol series (70% ...
-
bioRxiv - Molecular Biology 2024Quote: ... The thymidylate synthase inhibitor 5-fluoro-2’-deoxyuridine (FUDR) (Sigma Aldrich, cat. no. F0503-100MG) was used at 5µM to select for parasites containing the correct integration ...
-
bioRxiv - Immunology 2024Quote: ... Samples were blocked with permeabilization/block buffer (1X PBS, 5% BSA, 2% Triton-X (Sigma)) for 1 hr at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mL of growth media supplemented with 5 mg/mL 6-aminocaproic acid (Sigma-Aldrich) was added to each well ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 8.5 with 5 mM tris (2-carboxyethyl)phosphine hydrochloride (Sigma-Aldrich Cat No: C4706) for 30 min at 35°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 hemisphere of each mouse brain without cerebellum and olfactory bulbs was placed in FACS buffer (1x DPBS, 2% FCS and 2 mM EDTA) + 5 μM Actinomycin D (ActD, Sigma, Cat#A1410-5MG) for transcriptomics ...
-
bioRxiv - Microbiology 2024Quote: ... zebrafish larvae were injected at 2 dpf with a 1:5 dilution of LC in PBS + 2% phenol red (Millipore Sigma, Cat # P0290) in the caudal vein ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Hs 766T were plated at a density of 2×104 cells/cm2 and were treated for six days with 100 μM 5-aza-2’deoxycytidine (Sigma Aldrich, St. Louis, MO) or for 24 hours with 50 nM Trichostatin A (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Three different replicas of the irradiated cell lines and the negative control were incubated at 37°C in a 5% CO2 atmosphere for 48 h with the thymine analog 5-bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich, St. Louis, MI, USA). Colcemid was added 24 h before the extraction ...
-
bioRxiv - Cancer Biology 2021Quote: ... a sterile β-mercaptoethanol solution was prepared (5 μl of 2-mercaptoethanol (Sigma-Aldrich, Munich, Germany)) in 8.45 ml of PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Brdu-ChIP was performed after addition of 20 μM BrdU (5-bromo-2′-deoxyuridine, Sigma Aldrich) directly to HeLa culture medium for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3.5 minutes at 5 μL/min with 2% Acetonitrile MS grade (Sigma Aldrich, Cat# 1207802), 0.1% formic acid (FA ...
-
bioRxiv - Microbiology 2020Quote: ... For this, NHS-CF555 (5 µl, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNP (500 µl) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... mouse α-tubulin clone B-5-1-2 (1:1000; Sigma Aldrich, San Luis, MO, U.S.). For immunofluorescence primary antibodies were labeled with Alexa-conjugated secondary antibodies Alexa 488 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 -5 mg of MeHA was dissolved in 1 mL Deuterium oxide (D2O) (Sigma Aldrich, 151882) and then tested with 300MHz 1HNMR with 10 ms time scale ...
-
bioRxiv - Microbiology 2020Quote: ... Senescence was induced by treating cells with 100 µM 5-Bromo-2’-deoxyuridine (Sigma Aldrich, USA) for 48 hours ...
-
bioRxiv - Systems Biology 2021Quote: ... the proteins the samples were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP; Sigma-Aldrich) for 20 minutes in 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µM of 5’heyxynyl-dT50 (IDT) were mixed with 2 mM of CuSO4 (SIGMA, C1297) and DDW ...