Labshake search
Citations for Millipore Sigma :
751 - 800 of 10000+ citations for Cow Fructose 1 6 Bisphosphatase 2 FBP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...
-
bioRxiv - Immunology 2020Quote: ELISA plates (Cat. M5785, Sigma Aldrich) were first coated overnight at 4°C with 10μg/ml of each B cell peptide epitope ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ghrelin ELISA (EZRGRA-90K)(Sigma Aldrich) IGF-1 ELISA (Catalog #80574 ...
-
bioRxiv - Immunology 2022Quote: – Antibody enzyme conjugates for ELISA (Sigma): Peroxidase conjugated Anti-mouse polyvalent immunoglobulins (IgG ...
-
bioRxiv - Physiology 2020Quote: ... pancreatic glucagon and GLP-1 content were measured using glucagon ELISA (EZGLU-30K, Merck Millipore), or RIA kit (250-tubes GL-32K ...
-
bioRxiv - Bioengineering 2019Quote: ... and complement C5a levels in serum were quantified by ELISA (Histamine kit: Enzo Life Sciences, Farmingdale, NY; Complement C3a kit: Quidel, San Diego, CA; Complement C5a kit: Sigma-Aldrich, St. Louis, MO). Spleen tissues were homogenized with a FastPrep-24 instrument in RIPA buffer supplemented with EGTA ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines tested and confirmed to be mycoplasma free using the Mycoplasma PCR ELISA kit (Sigma). CENP-A overexpression was induced by the addition of Dox to typical growth media at 10ng/ml (considered 1X) ...
-
bioRxiv - Neuroscience 2021Quote: ... The BDNF of offspring hippocampus was measured using the ChemiKineTM BDNF Sandwich ELISA kit (CYT306; Chemikine, Millipore). A total of 80 µg/well of hippocampus protein was used and samples were analysed in duplicates ...
-
bioRxiv - Cell Biology 2019Quote: ... The CRP concentration in mouse serum was measured using the mouse CRP ELISA kit (Sigma-Aldrich, RAB1121) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: Cell proliferation activity was measured by BrdU incorporation assay using a Cell Proliferation ELISA kit (Sigma-Aldrich). The wells of 96-well plates were seeded with 5000 HSC-2 or HO-1-N-1 cells ...
-
bioRxiv - Genetics 2021Quote: ... leptin and adiponectin were measured in plasma from fasted mice using ELISA kits from Millipore (EZRMI-13K), Mercodia (10-1281-01) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Albumin was measured in the cell culture medium by Human ALB/Serum albumin ELISA Kit (Sigma-Aldrich) and in the cell lysate by qPCR ...
-
bioRxiv - Neuroscience 2024Quote: Neuropeptide Y levels in tissue were measured with commercially available ELISA kit (EMD Millipore, EZHNPY-25 K). Mice were anesthetized with isoflurane and euthanized by decapitation ...
-
bioRxiv - Neuroscience 2020Quote: ... Before injecting 6-hydroxydopamine (6-OHDA, Sigma), mice were first treated with a mix of desipramine (25 mg/kg ...
-
bioRxiv - Developmental Biology 2023Quote: 6-Hydroxydopamine hydrochloride (6-OHDA) (Sigma, H4381)
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Cell Biology 2023Quote: ... post-fixed in cooled ethanol:acetic acid (2:1) and stained using a TUNEL kit (ApopTag® Fluorescein In Situ Apoptosis Detection Kit, Merck Millipore, #S7110) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-acetylated tubulin (6-11B-1; 1:1000 for IF; Cat#6793, Sigma), mouse monoclonal anti-glutamylated tubulin (B3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Millipore-Sigma, cat#: MABT868), 1:600 rabbit anti-FMRFamide (Immunostar ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Millipore-Sigma, cat#: MABT868), 1:600 rabbit anti-FMRFamide (Immunostar ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse acetylated tubulin antibody was incubated at 1:1000 from Sigma (6-11B-1). Secondaries Alexa fluorophores anti-rabbit 488 and anti-mouse 647 were used at 1:1000 dilutions.
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-acetylated α-tubulin clone 6-11B-1 1:100 (Sigma Aldrich) and mouse polyclonal anti-PAR2 1:100 (T ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-acetylated α-tubulin clone 6-11B-1 1:2000 (Sigma Aldrich). Bound antibodies were detected using peroxidase-labeled anti-rabbit IgG (GE Healthcare) ...
-
bioRxiv - Zoology 2019Quote: Primary antibodies: mouse monoclonal 6-11B-1 for acetylated tubulin (diluted 1:1000; Sigma), mouse monoclonal 3C11 for synapsin (SYNORF1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2-(5-Benzo [1,3] dioxol-5-yl-2-tert-butyl-3HImidazol-4-yl)-6-methylpyridine hydrochloride hydrate (SB505124) (Sigma-Aldrich; St. Louis, MO) and implanted subdermally ...
-
bioRxiv - Bioengineering 2021Quote: ... was used to stain the sections for EdU and 4′,6-diamidino-2-phenylindole (DAPI; #D9542; 1:1000 dilution; Sigma-Aldrich, St. Louis, MO, USA). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... containing 1% 2-mercaptoethanol (Sigma) and stored at -80°C until the RNA extraction ...
-
bioRxiv - Bioengineering 2021Quote: ... with 1% 2-Mercaptoethanol (Sigma). Total RNA was extracted using RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... + 1% 2-Mercaptoethanol (Sigma Aldrich) at -80 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 mM 2-mercaptoethanol (Sigma), and 12.5 µg/mL of basic fibroblast growth factor (bFGF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 mM 2-mercaptoethanol (Sigma), and 1000 units/mL leukemia inhibitory factor ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U.μl-1 Benzonase (Novagen) and 4 mM MgCl2 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2-hexanone (Sigma 103004), 1% 2-phenylethanol (Sigma 77861) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2-phenylethanol (Sigma 77861), 1% 3-methyl-1-butanethiol (Sigma W385808) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2-heptanone (Sigma 53768315), 1% linalool (Sigma L2602) ...
-
bioRxiv - Genomics 2022Quote: ... with 1% 2-Mercaptoethanol (Sigma), vortexed briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 1% 2-mercaptoethanol (Sigma) to be able to use for RNA extraction.
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl 2-Butanone (Sigma) in 1,000 μl ethanol ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1-phenyl-2-thiourea (Sigma) was added at 30 mg/l to prevent embryonic pigmentation.