Labshake search
Citations for Millipore Sigma :
751 - 800 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with 10 μM DAPT (N-[N-(3, 5-difluorophenacetyl)-l-alanyl]-s-phenylglycinet-butyl ester) and 4 μM TAT-cre (Millipore, cat. no. SCR508) overnight.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The colorimetric signal was subsequently detected using nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP, Sigma-Aldrich, MO, USA) at 37 °C for a duration of 10 minutes.
-
bioRxiv - Plant Biology 2024Quote: ... medium lacking Trp but containing 40 μg mL-1 5-bromo-4-chloro-3-indolyl-α-D-galactopyranoside (X-α-gal; Sigma‒Aldrich) at 30°C for 3 days ...
-
bioRxiv - Microbiology 2024Quote: ... Membrane protein topology was assayed by plating the resulting reporter strains on dual-indicator plates containing LB agar supplemented with 80 μg/ml 5-bromo-4-chloro-3-indolyl phosphate disodium salt (X-Phos) ([Sigma Aldrich], RES1364C-A101X) and 100 μg/mL 6-chloro-3-indolyl-β-d-galactoside (Red-Gal ...
-
bioRxiv - Biochemistry 2024Quote: ... Bands were visualized using the nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (BCIP/ NBT, Sigma-Aldrich, St. Louis, MO, USA) reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... oral gavage for 21 days, using a 4-day-on, 3-day-off schedule) (Selleckchem, S7694), tamoxifen (20mg/kg, subQ, 5 doses/week) (Sigma Aldrich, T5648-1G), abemaciclib (75mg/kg ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.2 mg/mL sheared salmon sperm DNA and 2 mg/mL BSA) containing 50 ng of or HLA-B-biotin DNA probe (5’ TGTCCTAGCAGTTGTGGTCATCGGAGCTGTGGTCGCTGCTGTGAT-biotin 3’) (Sigma-Aldrich, USA) in a humidified chamber overnight ...
-
bioRxiv - Cancer Biology 2022Quote: Cell proliferation was assessed by the colorimetric assay of sulforhodamine B 2-(3-diethylamino-6-diethylazaniumylidene-xanthen-9-yl)-5-sulfo-benzenesulfonate (SRB) (Sigma Aldrich, USA)[25] ...
-
bioRxiv - Neuroscience 2023Quote: ... The cells were washed 3 times with 1x PBS and incubated for 2 hours with 5% goat serum (NGS -Sigma-Aldrich, G9023) in 1x PBS with 0.3% Triton (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... The locus with expected insertion was amplified by PCR using 5 μL KOD Hot Start 2× Master Mix (Sigma Aldrich 71842-3), 0.2 μL each primer at 10 μM ...
-
bioRxiv - Genetics 2020Quote: ... containing either tunicamycin only (Enzo Life-Sciences; 2-3 μg/mL) or tunicamycin and auxin (IAA, indole-3-acetic acid, Sigma-Aldrich; 1 mM), and seeded with OP50-1 bacteria ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... and next 3 chamber volumes of 5 mg/ml κ-casein (Sigma, C0406) dissolved in MRB80 ...
-
bioRxiv - Cell Biology 2024Quote: ... Treated films were immediately incubated in 5% (3-Aminopropyl)triethoxysilane (APTES, Sigma, 440140) in ethanol (dark ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Biochemistry 2023Quote: ... Ro 20-1724 [4-(3-butoxy-4-methoxy-benzyl) imidazolidone] was purchased from Sigma Aldrich (catalog no. B8279); stock concentrations were made at 100 mM in DMSO.
-
bioRxiv - Cancer Biology 2020Quote: ... The antibody reaction was visualized with 3-3’ diaminobenzidine (Sigma, D8001) followed by counterstaining with hematoxylin ...
-
bioRxiv - Neuroscience 2022Quote: ... prior to being rinsed and reacted using 3-3’diaminobenzidine (Sigma) as chromagen ...
-
bioRxiv - Biochemistry 2021Quote: ... and 3’,3’c-di-AMP were purchased from Sigma-Aldrich, 2’,3’-cGAMP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimidehydrochloride (EDC) were procured from Sigma Aldrich, USA.
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT, Sigma). Selection plates were left for 8 days at 30°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate (CHAPS) (C3023; Sigma Aldrich), and sodium dodecyl sulfate (SDS ...
-
bioRxiv - Plant Biology 2022Quote: ... and crosslinked using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma). Biotin-labelled probes were hybridized with sRNAs on the nylon membrane and stabilized streptavidin-horseradish peroxidase was used to detect the biotin signal.
-
bioRxiv - Synthetic Biology 2023Quote: ... activated with 250mM 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma)/ N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Systems Biology 2024Quote: ... 5µM 6-bromoindirubicin-3-oxime / GSK-3 inhibitor (Sigma, 361550-1MG) and 100 µg/ml Primocin (InVivogen ...
-
bioRxiv - Systems Biology 2024Quote: ... or 3-bromopyruvate (3-BP; Sigma-Aldrich, St. Louis, MO; 16490) were added to their respective wells ...
-
bioRxiv - Biophysics 2024Quote: ... 15 mM 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (Millipore Sigma E6383), 5 mM N-hydroxysuccinimide (NHS ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μl of the reducing reagent (mixture of 0.2 g 1-amino-2-naphtol-4-sulfonic acid (Millipore-Sigma, Burlington, MA, USA, #08751) with 0.2 g sodium bisulfite (Millipore-Sigma ...
-
bioRxiv - Physiology 2023Quote: ... In order to substitute cholesterol in the patch with cholest-4-en-3-one (cholestenone) the bath solution was replaced with 2 mM MBCD solution saturated with cholest-4-en-3-one (Millipore-Sigma, St. Louis, MO).
-
bioRxiv - Immunology 2021Quote: PBMCs and tissue MNC suspensions were treated with 5 μM Chk2 inhibitor II or 2-[4-(4-chlorophenoxy)phenyl]-1H-benzimidazole-5-carboxamide (Sigma) prepared in final volume of 1% bovine serum albumin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... 5,6- dichloro-1-beta-ribo-furanosyl benzimidazole (DRB, Sigma cat #D19116), 100 μM for 4 hours (34) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed 3 times in PBS and fixed in 4% paraformaldehyde (Sigma Alrich) PBS for 20 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: OPC primary cells were treated with JMJD3 inhibitor (GSKJ-4, 3 µM, SML0701, Sigma) for 48 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... samples were blocked for 4 h in 3% bovine serum albumin (BSA, Sigma-Aldrich) blocking buffer solution at RT ...