Labshake search
Citations for Millipore Sigma :
7801 - 7850 of 10000+ citations for 6 Ethyl 1H indole 2 3 dione 3 O 4 4 4 trifluoro butyl oxime since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and cover slips were placed with mounting media (50% glycerol, [Sigma] and 4% propyl gallate [Sigma, #2370]).
-
bioRxiv - Immunology 2024Quote: ... and cover slips were placed with mounting media (50% glycerol, [Sigma] and 4% propyl gallate [Sigma, #2370]).
-
bioRxiv - Cell Biology 2024Quote: ... then incubated rocking overnight at 4°C with 1:3000 dilution of anti-FLAG antibody (Sigma #F1804) and 1:10,000 dilution of anti-PGK1 antibody (Invitrogen #459250 ...
-
bioRxiv - Microbiology 2024Quote: ... The buffer was prepared using the following stock solutions48: 1) 4 kU/ml glucose oxidase (G2133, Sigma), 20 kU/ml catalase (C1345 ...
-
bioRxiv - Cell Biology 2024Quote: Worms were placed on 4 µl of M9 worm buffer in a poly-D-lysine (Sigma, P1024)-coated slide and a 24×24-cm coverslip was gently laid on top ...
-
bioRxiv - Neuroscience 2024Quote: ... and stored at 4°C in 1X PBS containing 0.02% (w/v) sodium azide (NaN3; Sigma Aldrich).
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated in primary antibodies at 4°C overnight (1:1000 for mouse anti-synaptophysin, Sigma Cat ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were spun for 4 minutes at 400g and resuspended in PBS+ 0.5% BSA (Sigma-Aldrich, A2153) and kept on ice for subsequent analysis.
-
bioRxiv - Biophysics 2024Quote: ... and 33% Precipitant Mix 4 (11% MPD, 11% PEG 1,000, and 11% PEG 3,350 from Sigma Aldrich), maintained at 20°C ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... cultures were washed with phosphate buffered saline (PBS) and fixed with 4% w/v paraformaldehyde (PFA; Sigma) with PBS for 1 hour ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Purified protein was concentrated using an Amicon Ultra-4 Centrifugal 50 kDa Filter Units (Sigma Aldrich NV). Protein was quantified against a standard curve made with Bovine Serum Albumin (BSA) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were lysed at 4 °C in RIPA buffer containing protease and phosphatase inhibitors cocktail (Promega/Sigma). Proteins were separated by SDS-PAGE and transferred onto 0.45 µm pore size Immobilon PVDF membrane (Millipore) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then refixed in 4% PFA for 5 min at RT then incubated in 2xSSC (Sigma) for 2 x 5 min RT ...
-
Micro topographical instruction of bacterial attachment, biofilm formation and in vivo host responsebioRxiv - Microbiology 2022Quote: ... A mould fluorosilane release agent, trichloro (1H, 1H, 2H, 2H-perfluorooctyl) silane (Sigma Aldrich) was applied using vapour deposition ...
-
bioRxiv - Bioengineering 2022Quote: ... and coated with trichloro[1H,1H,2H,2H-perfluorooctyl]silane (Sigma-Aldrich, Catalog 448931).
-
bioRxiv - Cell Biology 2019Quote: ... the master mold was silanized with trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma) for easier lift-off ...
-
bioRxiv - Microbiology 2021Quote: ... collected droplets were broken with 1H,1H,2H,2H-perfluoro-1-octanol (Sigma-Aldrich) to collect beads ...
-
bioRxiv - Microbiology 2022Quote: ... and subsequently treated overnight with Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma 448931). The next day ...
-
bioRxiv - Cell Biology 2020Quote: ... The emulsion was broken with 1H,1H,2H,2H-Perfluoro-1-octanol (Sigma Aldrich) and the beads washed three times in TBEST ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mL of 20% PFO (1H,1H,2H,2H-perfluoro-1-octanol, Sigma, 370533) and 5 mL of PBST buffer (0.4% tween 20 in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Tetramethylrhodamine ethyl ester perchlorate (Sigma, 87917), MitoSOX™ Red Mitochondrial Superoxide Indicator (Thermo Fisher M36008) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 70 ml ethyl acetate (Sigma) and incubated at 37℃ for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... ethyl butyrate (EBR, Sigma-Aldrich, E15701), and isopentyl acetate (IPA ...
-
bioRxiv - Cell Biology 2024Quote: ... and 20 μl ethyl acetate (Sigma) and then incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... and Fibronectin for >1h (Sigma, F1141 ...
-
bioRxiv - Biophysics 2021Quote: ... and (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, A3648) in a v:v:v ratio of 100:5:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cultured on 3% polyHEMA (Sigma, P3932) coated 96 well plate for 48 h in a 37 °C humidified incubator with 5% carbon dioxide.
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 1i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat.no ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Sigma), 50mM EDTA ...
-
bioRxiv - Cell Biology 2020Quote: ... – 50 μM in DMSO (3) Tunicamycin (Sigma) – 5 μg/ml in DMSO for 6hr (4 ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Genetics 2021Quote: ... Ni-NTA resin (EMD Millipore, 70691-3) was used to remove unreacted His-tagged nanobodies and His-tagged Sortase 5M enzyme ...
-
bioRxiv - Biochemistry 2020Quote: ... or 3) Lipopolysaccharide (LPS) (Sigma-Aldrich L3024) + interferon-γ (IFNγ ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 mM deferoxamine from Sigma (# BP987). Next ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-Indoleacetic acid (Auxin, Sigma-Aldrich, I2886) was dissolved in 100% ethanol and diluted 400 times in the culture medium obtaining concentrations as indicated ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3% Bovine Serum Albumin (BSA; Sigma, A2153), 0.5% Triton™X-100 (Sigma ...