Labshake search
Citations for Millipore Sigma :
7701 - 7750 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM TCEP and 5% glycerol pH 8.0) supplemented with ∼10 mg lysozyme (Millipore Sigma, L1667), 25 μl/ml BioLock biotin blocker (IBA ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... After blocking with 5% bovine serum albumin (Roth, Karlsruhe, Germany) or 5% skim milk (Sigma Aldrich) in TBS pH 7.4 plus 1% Tween-20 for 1 h (RT) ...
-
bioRxiv - Cell Biology 2022Quote: ... BMDMs on the dishes were washed with 5 ml of ice-cold PBS supplemented with protease inhibitor and phosphatase inhibitor (1:10 11836170001, Sigma-Aldrich, 1:100 P5726, Sigma Aldrich – PBS/c) and scratched in 2 ml PBS/c ...
-
bioRxiv - Genetics 2020Quote: ... incubated for 3 hours at 25 °C with the secondary antibody (anti-rabbit IgG peroxidase 1:10000, Sigma-Aldrich; anti-mouse IgG peroxidase 1:10000, Sigma-Aldrich; in 5% milk, 1xTBS,0,1% Tween) and washed 3 times with 1xTBS/0.1% Tween ...
-
bioRxiv - Immunology 2022Quote: ... Transduction was carried out two times for 24 hours and transduced cells were selected with appropriate antibiotics (5 μg/ml blasticidin, MP Biomedicals, Santa Ana, CA, USA; 1 μg/ml puromycin, Sigma Aldrich; or 1 mg/ml geneticin (G418), Santa Cruz ...
-
bioRxiv - Cell Biology 2022Quote: ... incubated at room temperature with secondary antibodies coupled to horseradish peroxidase (1:20,000 Thermo Fisher goat-anti-rabbit, or 1:20,000 Millipore Sigma goat-anti-rat in 5% nonfat dry milk). Membranes were washed again in PBS containing 0.1% Tween 4 x 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The treated samples were washed again with TBST 5 times the second day and mounted with PBS+50% glycerol supplemented with DAPI (Sigma, D9542, 1 μg·mL−1, St. Louis, MO, USA) or H33342 nuclear dye (Sigma ...
-
iDePP: a genetically encoded system for the inducible depletion of PI(4,5)P2 in Arabidopsis thalianabioRxiv - Plant Biology 2020Quote: ... coli (Novagen and Supplementary file 5) were transformed with pMH-HS-Sumo-dOCRL168-509 vector (KanR ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5-diphenyl-tetrazolium bromide (Sigma-Aldrich) powder ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5□µg/ml human insulin (Sigma), 100 U/ml penicillin and 100□μg/ml streptomycin (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... apo-transferrin (5 µg/ml, Sigma), superoxide-dismutase (0.8 µg/ml ...
-
bioRxiv - Biophysics 2020Quote: ... Blebbistatin 5 μM 1h (Sigma Aldrich), Latrunculin A 0.12 μM 2h45 (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5 nM monensin (Sigma Aldrich). The fluorescence of each well was measured using a Varioskan Lux plate reader (Thermo Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μg/ml insulin (Sigma; I6634), 0.1 nM cholera toxin (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 µM XAV939 (Sigma-Aldrich X3004); 10 µM SB203580 (Tocris 1402) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μg/ml NAC (Sigma A8199), and 10 μM Hydrocortisone (Sigma H0888) ...
-
bioRxiv - Immunology 2021Quote: ... 2 μL Betaine (5 M Sigma), 0.5 μL DTT (100 mM) ...
-
bioRxiv - Developmental Biology 2021Quote: ... CDDP (5 mg/kg) (Millipore Sigma) or CTX (150 mg/kg ...
-
bioRxiv - Genetics 2020Quote: ... and Penicillin (5 U/ml, Sigma). All lines used in this study were certified to be free of mycoplasma by a qPCR [47] with a detection limit below 10 genomes/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 5 g/L of NaCl (Sigma); 2.5 g/L of dipotassium hydrogen phosphate (Macron)] or TSB with 0.5% glucose (TSBg) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% of 1,6-hexanediol (Sigma-Aldrich) was added after anti-IgM stimulation.
-
bioRxiv - Microbiology 2019Quote: ... with 5% 2-mercaptoethanol (Sigma-Aldrich). Samples were boiled for 5 minutes at 95°C before separation on a gradient 4-20% SDS-PAGE gel (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5% Goat serum (Sigma, G9023). Samples were incubated with the primary antibody in blocking solution overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Following blocking in 5% Milk (Sigma) in TBST ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 mg of tamoxifen (Sigma #T5648) were administered by gavage to pregnant females ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ug linear polyacrylamide (Sigma-Aldrich) was included as a neutral carrier for RNA precipitation ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% dimethyl sulfoxide (DMSO; Sigma, D8418), 1% bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Vinculin (VIN-11-5, Sigma). Primary antibodies were detected with HRP-conjugated anti-rabbit or anti-mouse IgG and visualised with Immobilon Western HRP substrate (Merck).
-
bioRxiv - Cancer Biology 2020Quote: ... 5 mM EDTA (E7899, Sigma-Aldrich), and 2.5% FBS (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM Vanadyl ribonucleoside comples (Sigma), 0.5% Triton X-100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked with 5% BSA (Sigma-Aldrich) in 0.1% TritonX-100 at RT for 1 hr ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... 5 mM glucose (All Sigma-Aldrich), and 0.4% (w/v ...
-
bioRxiv - Genomics 2020Quote: ... 5 uM retinoic acid (Sigma, R2625) was added with LIF-deprived medium and auxin was also added continuously to the CTCF-depleted cell samples ...
-
bioRxiv - Biochemistry 2021Quote: ... control non-TRE: 5’CCTGCGTAGTTCCATAAGGATAGC (Sigma).
-
bioRxiv - Genomics 2020Quote: ... 5% Eosin Y (Sigma-Aldrich, USA) in 0.45M Tris acetate (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 5% heat-inactivated horse serum (Sigma), 2mM L-glutamine ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μg/ml polybrene (Sigma-Aldrich) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... Cytocholasin B (5 μM, Sigma-Aldrich) was used to determine non-specific glucose uptake ...
-
bioRxiv - Molecular Biology 2019Quote: ... and Penicillin (5 U/ml, Sigma). These lines and variants described below were confirmed to be free of mycoplasma contamination by a qPCR (Janetzko et al. ...
-
bioRxiv - Microbiology 2019Quote: ... with 5% 2-mercaptoethanol (Sigma M6250), and boiled for 10 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... or 5 mM GSH (Sigma, G4251), the chemicals were added at 4 hpi ...
-
bioRxiv - Physiology 2019Quote: ... or 5 μM prostaglandin (Sigma-Aldrich) were added ...
-
bioRxiv - Genomics 2019Quote: ... blocked in 5% donkey serum (Millipore)/0.3% Triton-X-100/PBS for one hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μM trichostatin (TSA, Sigma T8552) and 0.5 mM nicotinamide (NaM ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5 μg actinomycin D (Sigma). Enzymatic digestion was performed in Hibernate A-Ca medium with 2 mg/ml papain ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM sodium fluoride (Sigma-Aldrich), 120 nM okadaic acid (EMD Millipore) ...
-
bioRxiv - Neuroscience 2019Quote: ... and/or rapamycin (5 nM; Sigma) for 24h prior to RNA isolation or collection of culture supernatant.
-
bioRxiv - Genomics 2019Quote: ... 5 μg/mL insulin (Sigma I9278) and 3 × 10−5 mM hydrocortisone (Sigma H0888 ...
-
bioRxiv - Molecular Biology 2020Quote: 5-aza-2’-deoxycytidine (Sigma A3656) was dissolved to 10 mM in sterile water and frozen in one-time-use aliquots at −80°C ...
-
bioRxiv - Immunology 2019Quote: ... and 5 mg/mL achromopeptidase (Sigma). Following ...