Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for Human Galectin 3 LGALS3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Human IFNγ was purchased from Sigma Millipore ...
-
bioRxiv - Microbiology 2022Quote: ... complete human serum (Sigma Aldrich, H6914) or heat-inactivated human serum (Sigma Aldrich ...
-
bioRxiv - Microbiology 2022Quote: Pooled human γ-globulins (G4386; Sigma) serially diluted in medium 199 containing 1% FCS were mixed 1:1 with 100 PFU of each selected virus in medium 199 containing 1% FCS ...
-
bioRxiv - Immunology 2023Quote: ... 1 mg/mL human fibrinogen (Millipore), and 10 U/mL heparin (Sigma-Aldrich)).
-
bioRxiv - Immunology 2023Quote: ... kappa from human myeloma (Millipore-Sigma) in blocking buffer in the range 2000-15.625 ng/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... coated with human fibronectin (Sigma-Aldrich). Plated cells were incubated at 37°C for 4 hours to allow cell attachment ...
-
bioRxiv - Immunology 2023Quote: ... kappa from human myeloma (Millipore-Sigma), ranging from 2000-15.625 ng/mL by 1:2 serial dilutions in coating buffer ...
-
bioRxiv - Immunology 2023Quote: ... kappa from human myeloma (Millipore-Sigma) in blocking buffer in the range 2000-15.625 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... kappa from human myeloma (Millipore-Sigma), ranging from 2000-15.625 ng/mL by 1:2 serial dilutions in coating buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10% human serum (Sigma) and antibiotics-antimycotic (1x ...
-
bioRxiv - Immunology 2023Quote: ... and 0.6 µl human serum (Sigma). After two washes with CyFACS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ug/ml human insulin (Sigma), 10 nM hydrocortisone (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 nM human insulin (Sigma-Aldrich), 25 nM dexamethasone ...
-
bioRxiv - Microbiology 2023Quote: ... and human (AB serum, Sigma-Aldrich) for 15 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... apo-transferrin (apo-transferrin human, Sigma), ferritin (equine spleen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-human Tubulin (T6074, Sigma) at 1:10 000 (WB ...
-
bioRxiv - Cell Biology 2023Quote: ... Human bronchial epithelial cells (16HBE14o-, Sigma) were maintained in medium consisting of α-MEM (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% human AB serum (Sigma-Aldrich) and 25 ng/mL IL-2 (Miltenyi Biotec) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:2000 human anti-CREST (Sigma) and donkey anti-human Dylight550 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-human-CEBPα (Sigma Aldrich, HPA052734) and the secondary antibody (HPR anti-mouse ...
-
bioRxiv - Bioengineering 2023Quote: ... rabbit anti-human Oct4 (Millipore, US), and rabbit anti-human HSP90 (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 1 % human albumin (Sigma). PBMC were thawed and rested overnight in X-Vivo-20 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% human AB serum (Sigma-Aldrich), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human P2RY12 (Sigma, HPA014518), rabbit anti-human PU.1 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... Insulin solution human (Sigma Aldrich, I9278);
-
bioRxiv - Biochemistry 2024Quote: ... human Glu-Fibrinopeptide B (Sigma-Aldrich) was recorded throughout the analysis for lock-mass calibration ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant human TNFα (Sigma Aldrich, #H8916), PGE2 (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... thrombin from human plasma (Sigma-Aldrich) and GelMA (8.7% w/v) ...
-
bioRxiv - Pathology 2024Quote: ... and 0.5mg human fibrinogen (Sigma-Aldrich) in a total volume of 100µL EHT culture media (Celo.Cardiomyocyte advanced culture media ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Bioengineering 2024Quote: IgG from human serum (Sigma-Aldrich) was incubated at 62°C for 30 min to induce aggregation ...
-
bioRxiv - Bioengineering 2024Quote: ... or human complement C1q (Sigma-Aldrich) were immobilized on a CM5 or C1 sensor chip (Cytiva ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 mg/mL human fibrinogen (Sigma), 10% Matrigel (Corning) ...
-
bioRxiv - Cancer Biology 2024Quote: ... raised against human ST3GAL1 (Sigma HPA040466) and ST3GAL2 (Abcam ab96028) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10nM recombinant human gastrin (Sigma; G9145), 5ng/mL recombinant human HGF (PeproTech ...
-
bioRxiv - Microbiology 2024Quote: ... 10 % human AB serum (Sigma-Aldrich), and 10 ng/ml recombinant human macrophage colony stimulating factor (Peprotech ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% human serum albumin (Sigma-Aldrich), 0.0002% heparin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Levels of nitrate and nitrite in plasma obtained from human and mice were estimated by a Griess colorimetric assay kit (Sigma chemicals) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secretion of the following cytokines was quantified with the MILLIPLEX® Human CD8+ T Cell Magnetic Bead Panel Premixed 17 Plex - Immunology Multiplex Assay kit (EMD-Millipore): IL-6 ...
-
bioRxiv - Immunology 2023Quote: ... EasySep™ Human CD56 Positive Selection Kit II) and were frozen down in CS10 CryoStor cell cryopreservation media media (Sigma-Aldrich).
-
bioRxiv - Neuroscience 2023Quote: ... and Aβ 1-42 using the Milliplex® MAP Human Amyloid Beta and Tau Multiplex Assay kit (Millipore Sigma HNABTMAG-68K). All kits were read on a MAGPIX® system (Luminex ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Genetics 2022Quote: ... Human Erythroleukemia (HEL) and human TF-1 cells were cultured in RPMI-1640 medium (Sigma Aldrich #R8758) supplemented with 10% Fetal Bovine Serum (Sigma Aldrich #F0926 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte- human fibrinogen mixture (Sigma-Aldrich). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte-human fibrinogen mixture (Sigma-Aldrich) and 2µL of the mixture is carefully pipetted into the microwell ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...