Labshake search
Citations for Millipore Sigma :
701 - 750 of 3483 citations for CD44 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... the 6x HIS tag region of the recombinant protein was removed following the vector manufacturers specifications (Novagen). This recombinant SmCI-1 was used to generate a rabbit anti-Sm-CI-1 polyclonal antibody using the Custom pAb service offered by Genscript.
-
bioRxiv - Microbiology 2022Quote: ... with the following modifications: Mouse anti-GST tag or mouse anti-His tag 1:200× (Sigma-Aldrich) and HRP-conjugated goat anti-mouse IgG 1:2,000× (Seracare Life Sciences ...
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Biochemistry 2023Quote: ... After several rounds of washing with His-AC washing buffer (supplemented with 0.1% Tween-20 (Sigma Aldrich), 0.1% NP-40 (Thermo Fischer Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Cancer Biology 2023Quote: ... pTB146 His-SUMO-mSTING (residues 139-378) was expressed in Rosetta (DE3) pLysS competent cells (Sigma-Aldrich). Cells were grown in 2xYT medium with 100 μg/mL ampicillin until they reached an OD600 of 1 ...
-
bioRxiv - Genetics 2023Quote: ... imidazole was removed from the eluted His-SIRT5 using ultra-0.5 centrifugal filter units (UFC501096, Merck Millipore). 500 µl of the recombinant SIRT5 elution fractionation was added to the ultra-0.5 centrifugal filter units and centrifuged at 14,000 x g for 15 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Genetics 2022Quote: ... Human Erythroleukemia (HEL) and human TF-1 cells were cultured in RPMI-1640 medium (Sigma Aldrich #R8758) supplemented with 10% Fetal Bovine Serum (Sigma Aldrich #F0926 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte- human fibrinogen mixture (Sigma-Aldrich). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte-human fibrinogen mixture (Sigma-Aldrich) and 2µL of the mixture is carefully pipetted into the microwell ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293-T cells were transiently transfected with GFP-V5 or GREP1-V5 fusion proteins using OptiMem and Fugene HD (Sigma-Aldrich, St. Louis, MO). 72 hours after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Bioengineering 2019Quote: ... Lyophilized proteins were purchased: human serum albumin (HSA; from human plasma, ≤0.02% Fatty acids, Lot #SLBZ2785, Millipore Sigma) and fibrinogen (FBG ...
-
bioRxiv - Biochemistry 2021Quote: Lyophilized human haptoglobin phenotype 1-1 (Hp) and human α,β haemoglobin (Hb) were purchased from Sigma Aldrich. Deglycosylation enzyme PNgase F was from New England BioLabs Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... The obtained antisera were affinity-purified with recombinant Emi2-His protein electroblotted onto a membrane (Immobilon; EMD Millipore).
-
bioRxiv - Molecular Biology 2020Quote: ... Sph2-YM4271 cells were grown on synthetic dropout (SD)-His media supplemented with the inhibitor 3 mM 3-amino-1,2,4-triazole (3-AT; Sigma). All Y1H effector plasmids were separately transformed into the Sph2-YM4271 reporter strain and plated on SD/-Leu plates ...
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Plant Biology 2019Quote: ... at least four independent colonies were used for yeast two-hybrid assay on SD-Leu-Trp-His plates with and without 3-amino-1,2,4-triazole (Sigma). Colonies were imaged every 24 h post plating for 4-5 days.
-
bioRxiv - Cancer Biology 2020Quote: ... The pETDuet-1-His-BAP1-ULD+ASXL2-AB protein complex was expressed in Rosetta 2 (DE3) pLysS (Millipore). The bacteria bearing the desired plasmids were propagated with aeration at 37°C in 1L of 2YT to an A600 absorbance of approximately 0.6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were then incubated for 4 hours with anti-His hexahistidine antisera conjugated to horseradish peroxidase (HRP) (Sigma) diluted in TBST at a ratio of 1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... Dialysis was performed in concert with cleavage of the His-SUMO tag using the SUMO protease (Sigma Aldrich) at 20U/1mg of protein ...
-
bioRxiv - Molecular Biology 2022Quote: CobB driven deacetylation of His-PrsAc was analyzed by Western blot with anti-acetyl lysine antibodies (Sigma/Merck) and mass spectrometry ...
-
bioRxiv - Microbiology 2021Quote: ... Bound proteins were detected by western blot using anti-His antibody and streptavidin-HRP conjugate (SIGMA, reference GERPN1231).
-
bioRxiv - Zoology 2020Quote: ... recombinant RhATG5 and RhATG5191-199Δ were affinity-purified using Ni-NTA His•Bind Resin (Merck-Millipore, Darmstadt, Germany). Recombinant RhATG5 and RhATG5191-199Δ were then incubated with 10µg μ-calpain (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... 2020) genes fused with an N-terminal His-tag sequence have been inserted into a pET28a vector (Novagen) for protein expression in E ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were cleaved by incubation with 1.5 % (w/w) His-tagged HRV-3C protease (Millipore Sigma SAE0045) or 15 U/mg His-tagged SUMO protease (Millipore Sigma SAE0067 ...
-
bioRxiv - Biochemistry 2021Quote: A C-terminal 10x His-tagged Synechocystis PCC 6803 ocp gene (slr1963) was cloned in a pCDFDuet (Novagen), resulting in a plasmid named pEP4 ...
-
bioRxiv - Cell Biology 2020Quote: Fixed cells were permeabilized using ice-cold Hi-C lysis buffer (10 mM TRIS-HCl pH 8 [Sigma] ...
-
bioRxiv - Bioengineering 2021Quote: ... aliquots of each fraction were visualized via immunoblotting (anti-His antibody; Cat: SAB2702218, Sigma Aldrich Canada, Oakville, Canada) to identify fractions enriched for RBD ...
-
bioRxiv - Cell Biology 2022Quote: ... HCP-1 was produced similarly but in Hi-5 cells maintained in EX-Cell 405 medium (Sigma-Aldrich) and collected after 66h infection ...
-
bioRxiv - Microbiology 2023Quote: ... The fractions containing His-SSRP1 were concentrated with an Amicon centrifugal filter unit (50 kDa cut-off, Millipore) and buffer exchanged into storage buffer (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Pathology 2023Quote: ... Then 2.4 µL of multiplexed PCR products were mixed with 9.35 µL of Hi-Di formamide (Sigma-Aldrich) and 0.15 µL of Genescan 500 Liz internal line size standard (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... the 6×His tag on the proteins was further cleaved with Thrombin CleanCleave kit (Sigma-Aldrich, Cat# RECMT) overnight at 4 °C on the rocking table after desaltig in 50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2023Quote: ... Supernatant was isolated and combined with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) His Bind resin (Novagen), equilibrated in lysis buffer and incubated for 1 hour at 4°C with gentle rotation ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions containing the His-tagged nucleotidases were pooled and concentrated using an Amicon 10 kDa MWCO filter (Millipore). The protein was buffer-exchanged into gel filtration buffer (100 mM HEPES pH 7.4 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Membranes were then incubated with anti-His primary antibody 1:5000 in 4% milk in PBS-T (Sigma) for 2 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM β-mercaptoethanol prior to application of the protein to His-Select Cobalt affinity gel (Sigma-Aldrich). The slurry was rotated for 60 min prior to application to a gravity flow column ...
-
bioRxiv - Biochemistry 2023Quote: ... and lysates were clarified by ultracentrifugation (20,000 x g for 20 min) and incubated with 0.4 mL of His-Select nickel resin (Sigma) for 1 h at 4°C with gentle mixing ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was flown through 500 μL of Roche cOmplete™ His-Tag purification resin (Millipore Sigma, #5893682001) for His-tag tagged proteins ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peak corresponding to mono-SPY-His-tagged streptavidin tetramer was collected and concentrated using Amicon 10K (Millipore). The concentrated mono-SPY-His6-tagged streptavidin tetramer was further purified through Hiload superdex75 (Cytiva ...
-
bioRxiv - Bioengineering 2023Quote: ... His-tagged GA-MatryoshCaMP6s were eluted in 1.5 mL 250 mM imidazole (Sigma-Aldrich; CAS 1467-16-9) 20 mM MOPS pH 7.0 ...
-
bioRxiv - Biophysics 2021Quote: PAI-1 (human recombinant, Sigma-Aldrich, Germany)
-
bioRxiv - Biophysics 2021Quote: Fibrinogen (human plasma purified protein, Sigma-Aldrich)
-
bioRxiv - Biophysics 2021Quote: ... PAI-1 (human recombinant, Sigma-Aldrich, Germany), Plasminogen (human plasma purified protein ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant human thrombin (1 U/ml, Sigma) was added to the bottom of a 3.0 µm costar polycarbonate transwell membrane insert (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... sativa–derived recombinant human albumin (Sigma-Aldrich), and 213μg/ml L-ascorbic acid 2-phosphate (Sigma-Aldrich) ...