Labshake search
Citations for Millipore Sigma :
701 - 750 of 9866 citations for 6 METHOXY THIOCHROMAN 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 4′,6-diamidino-2-phenylindole dihydrochloride (Sigma D8417). The sections processed for colorimetric immunohistochemistry were incubated with avidin-biotin-complex (Vector Laboratories PK-6100 ...
-
bioRxiv - Neuroscience 2022Quote: ... pups received 6-OHDA hydrobromide (Sigma-Aldrich, France) or vehicle in one of the lateral ventricles as described in [44] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10−6 M valsartan (Sigma-Aldrich, St.Louis, MO) or 5 μM Go6983 (Bio-Techne Corporation ...
-
bioRxiv - Cell Biology 2022Quote: ... and anti-GFP (6 μg/ml, Sigma #11814460001). AlexaFluor555 phalloidin (1:100 ...
-
bioRxiv - Genomics 2022Quote: ... 6 μL of 10% Tween-20 (Sigma Aldrich), 10 μL of 2% BSA (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6’-diamidino-2-phenylindole (DAPI) (#DUO82040, Sigma-Aldrich). A total of 7 images (on average of 60 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA (Sigma-Aldrich, 6381-92-6) and protease and phosphatase inhibitors (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, Sigma), diluted at 1 µg/ml in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... and 10 mM glucose-6-phosphate (G6P, Sigma) for 18 hours at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 µM Na3VO4 (Millipore Sigma, 13721-39-6), 50 µM UDP (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... Embryos were transferred to 6% Ficoll (Sigma-Aldrich) for injections ...
-
bioRxiv - Biochemistry 2023Quote: ... then resuspended in 6 M urea/PBS (Sigma) and reduced in 1 mM TCEP ...
-
bioRxiv - Biochemistry 2023Quote: ... then resuspended in 6 M urea/PBS (Sigma), reduced in DTT (9.26 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse IL-6 ELISA kit (Sigma, RAB0309), anti-mouse G-CSF ELISA kit (MCS00 ...
-
bioRxiv - Biophysics 2023Quote: ... or 6 M Guanidine (Sigma, Saint-Louis, USA). For non-crosslinked samples incubation times evaluated ranged from 5 min to 16 hours at room temperature (18°C) ...
-
bioRxiv - Bioengineering 2023Quote: ... against a 40% PEG (6 kDa; Sigma Aldrich) aqueous solution for 16 h to obtain a SF ink concentration between 15 and 20% ...
-
bioRxiv - Systems Biology 2023Quote: ... Fisher Scientific)/6% trifluoracetic acid (Sigma-Aldrich, HPLC grade, >99.9%) prior to resuspending the sample in 1 mL 80% acetonitrile (Optima LC-MS grade ...
-
bioRxiv - Bioengineering 2023Quote: The PS (6-10 μm from Sigma-Aldrich), PMMA (6-10 μm from Goodfellow) ...
-
A transient but very intense mutational burst occurs during the normal development of yeast coloniesbioRxiv - Genetics 2023Quote: ... Yeast Nitrogen Based 6 g/L (Sigma-Aldrich), agar 20 g/L (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... /6% trifluoracetic acid (Sigma-Aldrich, HPLC grade, >99.9%), once with 1 mL 80% acetonitrile ...
-
bioRxiv - Systems Biology 2023Quote: ... Fisher Scientific)/6% trifluoracetic acid (Sigma-Aldrich, HPLC grade, >99.9%) and vortexing the sample with the beads for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-chloropurine riboside (Sigma-Aldrich, cat. no 852481), 2-Chloroquinoline-3-carboxylic acid (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: Human recombinant IL-6 (Sigma-Aldrich, cat. I1395) was prepared as a 50 mg/mL stock solution in PBS/1%BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... clone GS-6 (Millipore-Sigma #MAB302, 1:1000) at 4 °C overnight or rabbit anti-HA (Invitrogen #MA5-27915 ...
-
bioRxiv - Neuroscience 2023Quote: ... clone GS-6 (Millipore-Sigma #MAB302, 1:1000) at 4 °C overnight or rabbit anti-HA (Invitrogen #MA5-27915 ...
-
bioRxiv - Microbiology 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (Sigma-Aldrich) was used to stain nuclear DNA ...
-
bioRxiv - Immunology 2024Quote: ... 6 mL 30% D(+)-Glucose (Sigma-Aldrich, #G8769), 13 mL 1M NaHCO3 (VWR ...
-
bioRxiv - Bioengineering 2023Quote: ... 6 µL 10% v/v tetramethylethylenediamine (TEMED) (Sigma) and 6 µL 10% w/v ammonium persulfate (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... using 6% sucrose solution (w/v, Sigma-Aldrich). They were presented with identical plastic bottles ...
-
bioRxiv - Physiology 2024Quote: ... 2mM Sodium pyruvate (113-24-6, Sigma-Aldrich),1 µM dexamethasone (SC-29059 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... To encapsulate Coumarin 6 (Sigma Aldrich, Darmstadt, Germany), the payload was dissolved in the chloroform phase before nanocarrier production ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI, Sigma) were used for counterstaining ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 mM cis-aconitate[25] (A3412, Sigma-Aldrich) and 0.5% Penicillin-Streptomycin at 2×106 parasites/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... 6.8 U glucose-6-phosphate dehydrogenase (Sigma #G5760), 6.8 U 6-phosphate gluconate dehydrogenase (Sigma #P4553) ...
-
bioRxiv - Biochemistry 2024Quote: ... 6.8 U 6-phosphate gluconate dehydrogenase (Sigma #P4553), 0.85 mg phosphoribulokinase from Synechocystis sp ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 µL 10% v/v tetramethylethylenediamine (TEMED) (Sigma) and 6 µL 10% w/v ammonium persulfate (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... 4’,6-diamidino-2- phenylindole (DAPI, Sigma, D9542) was diluted in the respective medium and added to the cultures at a final concentration of 10 ug/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... SMF cells and EMT6 cells were transduced at 50% confluency in 6-well plates with 1 mL of concentrated lentivirus and 6 µg/mL polybrene (Sigma 107689) at 1000xg and 33°C for 2 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... the electrode surfaces of 6-well Axion plates (Axion Biosystems, CytoView MEA 6) were coated with 10 mg/mL poly-D-lysine (Sigma, P7280) at room temperature overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were resuspended in 6 mL of cold water and lysed by adding them dropwise to 6 mL of boiling 8% SDS (Sigma-Aldrich) within 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were cultured on Greiner Bio-One CELLSTAR Polystyrene 6-well Cell Culture Multiwell Plates coated first with Poly-L-ornithine hydrobromide (6 μg/mL in 1xPBS (Sigma-Aldrich), 1 h at 37℃ ...
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...