Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for 6 Chloro 3 2 chloroethyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Treatment was followed by pulse-labelling for 20 minutes with 25 μM 5-Chloro-2′-deoxyuridine (CldU, Sigma) and then 20 minutes with 250 μM 5-Iodo-2′-deoxyuridine (IdU ...
-
bioRxiv - Cancer Biology 2023Quote: ... asynchronously growing subconfluent KB2P1.21 or KB2P3.4 cells were labeled with 30μM thymidine analogue 5-chloro-2’-deoxyuridine (CIdU) (#C6891, Sigma-Aldrich) for 20’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Polar metabolites were first methoximated with methoxyamine hydrochloride in pyridine (Sigma, 20 μl, 30 mg/ml, 2 hours, 37 °C) and then derivatized with TMS reagent (N,O-bis(trimethylsilyl ...
-
bioRxiv - Cancer Biology 2020Quote: Dried and frozen metabolite extracts were derivatized with 50 µl of 2% (w/v) hydroxylamine hydrochloride in pyridine (Sigma-Aldrich) for 60 min at 90°C ...
-
bioRxiv - Physiology 2023Quote: ... Dried and frozen metabolite extracts were derivatized with 50 µl of 2% (w/v) hydroxylamine hydrochloride in pyridine (Millipore Sigma) for 60 min at 90°C ...
-
bioRxiv - Neuroscience 2019Quote: ... after which 10 μM 6-TG (6-thioguanine or 2- amino-6-mercaptopurine, Sigma-Aldrich) with 200 μg/ml G418 selection was carried out for an additional 6-8 days ...
-
bioRxiv - Bioengineering 2023Quote: ... and blocked for 1h with 3% goat serum and 1% BSA in PBS/0.25% Triton X-100 (Sigma). The primary antibodies were incubated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mg of proteins were subsequently incubated for 1h with 10 μl of FAM134B or FAM134C antibodies (Sigma Prestige-HPA012077 and -HPA016492 ...
-
bioRxiv - Neuroscience 2024Quote: D1R agonist 2,3,4,5,-tetrahydro-7,8-dihydroxy-1-phenyl-1H-3-benzazepine hydrochloride (SKF38393; Sigma-Aldrich, St Louis, MO) was dissolved in sterile saline at a concentration of 0.5 μg/μL ...
-
bioRxiv - Molecular Biology 2021Quote: Anti-α-tubulin (Sigma-Aldrich, clone B-5-1-2), anti-METTL18 (PROTEINTECH GROUP ...
-
bioRxiv - Cell Biology 2019Quote: ... tubulin (clone 5-B-1-2 from Sigma, 1:5000), GST (clone 8-326 ...
-
bioRxiv - Microbiology 2021Quote: ... Cytosine b-D-arabinofuranoside (Ara-C) (2 µM; Sigma, C1768) was added once to remove proliferating cells from the culture and ensure long-term recordings of the cultures ...
-
bioRxiv - Biophysics 2020Quote: ... Mouse anti-α-tubulin (B-5-1-2) (T5168; Sigma), Mouse anti polyglutamylated tubulin ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-alpha-tubulin B-5-1-2 (Sigma, T5168), mouse anti-alpha-tubulin TAT-1 (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-tubulin MAb (clone B-5-1-2; Sigma) was used at a 1/4,000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Tubulin (clone B-5-1-2) from Sigma Aldrich and anti-MUC5AC (clone 45M1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Immunology 2023Quote: ... #22363548) in a 6 well plate containing 1.35 mM 2’-deoxyguanosine (2-dG, Sigma-Aldrich) in complete DMEM-10 (DMEM ...
-
bioRxiv - Pathology 2020Quote: Ela-Cre AT-1fl/+ and Ela-Cre AT-1fl/fl mice at 2-3 months of age were treated with tamoxifen (MP Biomedicals, 3mg/40g BW dissolved in 98% corn oil [Sigma] and 2% ethanol [Sigma]) by oral gavage once daily for three days to induce Cre recombinase activity ...
-
bioRxiv - Microbiology 2019Quote: ... A 200 μL aliquot of a solution containing 100 μg/μL of XTT (2, 3-(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) (Sigma-Aldrich, St Louis, MO, USA) and 10 μg/μL of PMS (phenazine methosulfate ...
-
bioRxiv - Microbiology 2020Quote: Three GS inhibitors were used to study the effect of GS on parasite infectivity and growth during liver stage development: 3-aminoimidazo[1,2-a]pyridine (Sigma Aldrich; Cat no. 685755; AIP), Glufosinate Ammonium (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... The bound probe was visualized using 5-bromo-4-chloro-3 indoyl phosphate (NBT/BCIP; Sigma-Aldrich Corp., St. Louis, MO, USA). Bright field images were captured on the A1+ Nikon confocal microscope fitted with a DS-Ri1-U3 color camera at 20x magnification and 4076×3116 pixel resolution ...
-
bioRxiv - Plant Biology 2020Quote: ... Detection was performed by adding 200 μl of western blue substrate (SIGMAFAST™ BCIP®/NBT = 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium, Sigma) followed by incubation at room temperature in a dark and moist environment until the reagent’s color became visible ...
-
bioRxiv - Neuroscience 2023Quote: ... Fixed cells were incubated with staining solution (1mg/mL of X-Gal,5-Bromo-4-chloro-3-indolyl-beta-D-galactopyranoside; Sigma Aldrich #11680293001)(Lorenzo ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Microbiology 2019Quote: Primers used in this study (Table 2) were designed with Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) and synthesized by Sigma-Aldrich.
-
bioRxiv - Cell Biology 2019Quote: Cell viability was assessed with 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, #M5655, Sigma Aldrich) after treatment with MMC and the PARP inhibitor Olaparib (AZD2281 ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Biochemistry 2021Quote: ... cell viability was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, MO) as described previously.52 Equivalent MTT assays were performed on cells cultured in the same ratios of PBS to media ...
-
bioRxiv - Microbiology 2021Quote: ... sporozoites were added to 1 ml molten 3% agarose (2-Hydroxyethyl agarose – Sigma-Aldrich, dissolved in ddH2O), centrifuged and incubated at 4°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... or 25 µM (L-3-trans-(Propylcarbamyl) oxirane-2-carbonyl)-L-isoleucyl-L-proline (CA-074me) (Sigma) to inhibit cathepsin B ...
-
bioRxiv - Molecular Biology 2020Quote: ... For cell treatments the following compounds were used: 2′,3′-Dideoxycytidine (1-10 μM, Sigma-Aldrich®), Ethidium bromide (50 ng/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and thus 3-[2-(diethylamino)ethyl]-7-hydroxy-4-methylcoumarin (AHMC; Cat. No. 188611, Sigma-Aldrich Corp.) was used instead as previously described for the fluorescence quantification (Donato et al ...
-
bioRxiv - Pathology 2019Quote: ... a cell-permeant NO scavenger 2-(4-car-boxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO) (Sigma) at a high concentration of 500 μM was included ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Microbiology 2019Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide was dissolved in Dulbecco’s PBS (-) (Sigma-Aldrich, India) (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 3 hours before addition of 30 μL of the bacterial growth reporter MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (2.5 mg/mL) (Sigma) and Tween 80 (10% ...
-
bioRxiv - Biochemistry 2020Quote: ... phosphatidyl-choline (2-oleoyl-1-palmityl-sn-glycero-3-phosphocholine) were from Sigma-Aldrich (St. Louis, MO); Ezetimibe and lysophosphatidylcholine (1-palmitoyl-sn-glycero-3-phosphocholine ...
-
bioRxiv - Developmental Biology 2020Quote: ... Phosphopeptide standards (0.1 pmol of MS PhosphoMix 1, 2, 3 Light; Sigma-Aldrich, St. Louis, Missouri, USA) was added to suspended sample in binding/equilibration buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... coli polar lipids (Avanti, US) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Sigma Aldrich) in a 3:1 molar ratio ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2 hours with blocking buffer (3% donkey serum in 0.1 M PBS; Sigma-Aldrich). Primary antibodies (ChAT ...