Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Flash-frozen plant samples (0.2 g) were ground and extracted using 2 mL of 3 % 5-sulfosalicylic acid (Sigma, ON, Canada). The extract was centrifuged for 10 min at 8050 x g at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... After 5 h of incubation the culture medium was de-proteinized by adding an equal volume of 3% trichloroacetic acid (Sigma # T6399) and incubation at 50 °C for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Cell Biology 2020Quote: ... Droplets were then demulsified by adding 1H,1H,2H,2H-perfluoro-1-octanol (Sigma Aldrich) dissolved in HFE-7500 (Novec ...
-
Anisotropic Rod-Shaped Particles Influence Injectable Granular Hydrogel Properties and Cell InvasionbioRxiv - Bioengineering 2021Quote: ... The hard master was vapor-coated with Trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Sigma) in vacuum ...
-
bioRxiv - Genomics 2022Quote: ... the collected droplets were broken by 1H,1H,2H,2H-perfluoro-1-octanol (Sigma-Aldrich). Next ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasma-activated and silanized with vapored trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Sigma-Aldrich) overnight ...
-
bioRxiv - Bioengineering 2021Quote: ... followed by 100 μl of 1H,1H,2H,2H-Perfluoro-1-octanol (PFO; Sigma-Aldrich) were added on top of the remaining top layer ...
-
bioRxiv - Bioengineering 2022Quote: ... molds were treated with vapor deposition of 1H,1H,2H,2H-perfluorooctyl-trichlorosilane (Sigma Aldrich) under vacuum for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... the collected droplets were broken with 1H,1H,2H,2H-perfluoro-1-octanol (Sigma-Aldrich) to collect the capsules ...
-
bioRxiv - Bioengineering 2022Quote: ... PDMS moulds were then functionalised using Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma, 448931). A few drops of silane were placed on a glass petri dish and into a desiccator together with the PDMS moulds ...
-
bioRxiv - Immunology 2021Quote: ... 5-A-RU was synthesised as described previously (120) and combined with methyl-glyoxal (Sigma-Aldrich) immediately before addition to the culture ...
-
bioRxiv - Pathology 2022Quote: ... Day 7 differentiated WT and ABHD4 KO 3T3-L1 adipocytes were labeled with 0.5 μCi [14C]-acetic acid or 5 μCi [3H]-oleic acid plus 0.04 mM oleic acid (Sigma-Aldrich) conjugated with 0.01 mM fatty acid free-bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2023Quote: ... Crypts were treated from seeding on with 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich).
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Cell Biology 2020Quote: ... NRCMs with serum-free DMEM no glucose media and ARCMs with serum-free media 199 for 16 h before treating with 4-methyl 2-oxopentanoic acid sodium salt (ketoleucine, Sigma), sodium-3-methyl-2-oxobutyrate (ketovaline ...
-
bioRxiv - Neuroscience 2020Quote: ... The lesions were made by injecting N-Methyl-D-aspartic acid (10 μg/μL NMDA in 0.9% saline; Sigma, Germany) into the dorsoventral and mediolateral hippocampus at 8 sites bilaterally at a flow rate of 0.15 μL/min (see (Table 1 for coordinates) ...
-
bioRxiv - Genetics 2020Quote: Serial ten-fold dilutions of logarithmic yeast cells were spotted on fresh Synthetic Dextrose (SD)-complete (or SD lacking a specific amino acid to preserve the plasmid) plates with or without different concentrations of Methyl methane sulfonate (MMS)(Sigma) and incubated at 30°C for three days ...
-
bioRxiv - Genetics 2024Quote: Serial 10-fold dilutions of logarithmic yeast cells were spotted on fresh synthetic dextrose (SD)-complete (or SD lacking a specific amino acid to preserve the plasmid) plates with or without different concentrations of methyl methanesulfonate (MMS) (Sigma) and incubated at 30°C for 3 days ...
-
bioRxiv - Microbiology 2021Quote: ... 3% B where solvent A = 0.1% formic acid (FA, Sigma) in water (Thermo-Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 50 mg/kg alizarin-3-methyliminodiacetic acid (Sigma, A3882) dissolved in 2% sodium bicarbonate solution were subcutaneously injected into mice at 5 day-intervals ...
-
bioRxiv - Neuroscience 2022Quote: ... A Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was additionally performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... A Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was additionally performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... hexadecanoic acid (CID: 57-10-3; Millipore Sigma; Catalog #:76119), heptadecanoic acid (CID ...
-
bioRxiv - Cell Biology 2023Quote: ... Erythroid progenitors were cultured with βOHB (3-Hydroxybutyric acid, Sigma), fatostatin (HY-14452 ...
-
bioRxiv - Cell Biology 2022Quote: ... into 3 volumes of concentrated sulfuric acid (>95%, Sigma-Aldrich) while stirring ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-indoleacetic acid (IAA) (500 μM, Sigma-Aldrich I5148-2G) was added overnight and present in the media in all the subsequent steps ...
-
bioRxiv - Cell Biology 2024Quote: ... were blocked with 3% fatty acid free BSA (#A7030, Sigma) in TBS for 1-2 hours at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... - 3-benzenedisulfonic acid (Tiron) and Bicyclomycin were purchased from Sigma.
-
bioRxiv - Biophysics 2023Quote: ... 50 mM 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS, Millipore Sigma), 0.3% N-lauroyl sarcosine (Millipore Sigma) ...
-
bioRxiv - Bioengineering 2023Quote: ... in 3% v/v aqueous acetic acid (A6283, Sigma-Aldrich) solution for 5 minutes ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM 2-Imino-1-imidazolidineacetic acid (cyclocreatine, Sigma-Aldrich), 50 µM NG,NG-Dimethylarginine dihydrochloride (ADMA ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 mM 3-mBz (m-toluic acid, Sigma-Aldrich) to induce msfGFP production ...
-
bioRxiv - Microbiology 2024Quote: ... 50mg 3-(Acrylamido) phenylboronic acid (Sigma Aldrich Cat No. 771465), 1ml 10X RNase-free TAE ...
-
bioRxiv - Immunology 2024Quote: ... and 15 acid-washed 3-mm glass beads (Sigma-Aldrich). Total RNA was isolated from a volume of lung homogenate equivalent to 30 mg of tissue using the RNeasy Tissue Kit and RNase-Free DNase Set (both Qiagen ...