Labshake search
Citations for Millipore Sigma :
701 - 750 of 7624 citations for 3 Methoxy Acetaminophen d3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Doxycycline (3 ug/ml, Sigma Aldrich) was added to induce TetO gene expression ...
-
bioRxiv - Bioengineering 2023Quote: ... or 3% BSA (Sigma-Aldrich, USA). 100,000 PEO4 cells were seeded on top of each coating and incubated for 2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 µM CHIR99021 (Sigma-Aldrich SML1046), 1 µM PD0325901 (Sigma-Aldrich PZ0162) ...
-
bioRxiv - Neuroscience 2024Quote: ... LY294002 (Sigma; Cat# L9908, 3 μM).
-
bioRxiv - Bioengineering 2024Quote: ... deionized water (Direct-Q 3 Millipore, Billerica ...
-
bioRxiv - Biophysics 2024Quote: ... x 3/32 in (Sigma-Aldrich) and Elbow Luer connector male (Thistle Scientific ...
-
bioRxiv - Plant Biology 2024Quote: A 3% Phloroglucinol (Sigma Aldrich, UK) - HCl solution (Weisner stain ...
-
bioRxiv - Molecular Biology 2024Quote: ... monothioglycerol (3 μL/mL, Sigma-Aldrich), BMP-4 (bone morphogenic protein 4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CHIR99021 (Sigma Aldrich, #SML1046, 3 µM), and Rspo3-Fc Fusion Protein Conditioned Medium (Immunoprecise ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM magnesium acetate (Sigma #63052), 0.1 mM EDTA (Invitrogen #AM9261) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x Benzonase (Millipore 70664-3). Protein was quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific 23225 ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... 3 µg/mL mitomycin C (Sigma) was added to induce the tailocin genes in the P ...
-
bioRxiv - Microbiology 2024Quote: ... dynasore (304448-55-3, EMD millipore), desatinib (BMS-354825 ...
-
bioRxiv - Plant Biology 2024Quote: ... PEG8000 (Sigma, Cat#25322-68-3) was added to the indicated final concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mM MgCl2 (Sigma-Aldrich, M2670), and 10 mM PIPES (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... indole-3-acetic acid (IAA)(Sigma) was added at a final concentration of 500 μM for the final 1 hour of the mitotic arrest treatment to induce the degradation of CENP-C-AID-eYFP ...
-
bioRxiv - Physiology 2024Quote: ... neostigmine (3 µM, Sigma Aldrich, USA), for 25 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM Na-pyruvate (Sigma, #P2256), 2 mM CaCl2.2H2O (Quality Biological ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM Na-pyruvate (Sigma, #P2256), 0.5 mM CaCl2.2H2O (Quality Biological ...
-
bioRxiv - Microbiology 2024Quote: ... 3 M Tris-HCl (Sigma Aldrich) at pH 8,8 was added to neutralize the acidic elution ...
-
bioRxiv - Biophysics 2024Quote: ... indole-3-acetic acid (IAA)(Sigma) was added at a final concentration of 500 μM for the final 12 hours of the mitotic arrest treatment to induce the degradation of CENP-N-eGFP-AID ...
-
bioRxiv - Microbiology 2024Quote: ... with 3% BSA (Sigma-Aldrich – A1906) in PBS for 20 min ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM KCl (Sigma-Aldrich, P405), and 0.1% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM KCl (Sigma-Aldrich, P405), and 0.1% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... 30°C (Sigma 3-16PK, Germany) to remove the non-soluble fraction of the nanocomposites ...
-
bioRxiv - Neuroscience 2024Quote: ... and .3% triton X (Sigma-Aldrich) in MilliQ water for 2 hours ...
-
bioRxiv - Plant Biology 2024Quote: ... and phosphatase inhibitor cocktail 3 (Sigma)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µM GSK3- inhibitor (CHIR99021, Sigma), 1 µM MEK-inhibitor (PD0325901 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3% horse serum (Sigma-Aldrich) was used for blocking.
-
bioRxiv - Bioengineering 2024Quote: ... Solvent Green 3 (Sigma-Aldrich, #211982), and Solvent Yellow 7 (#S4016) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3% β-mercaptoethanol (Sigma-Aldrich, M6250), 10 min at 95°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Millipore Sigma)/3% Fish Gelatin (G7765, Sigma Aldrich) and incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... carbonyl cyanide 3-chlorophenylhydrazone (CCCP, Sigma), 2-deoxy-D-glucose (2DG ...
-
bioRxiv - Cell Biology 2024Quote: Rosetta (DE3) cells (Millipore, 71397-3) were transformed with pET plasmids encoding 6xHis-3C-HA-TXNL1 (WT ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 3% (w/v) BSA (Sigma) was used to pre-block cells for 30min at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Glucose (Sigma-Aldrich, 3 mg/g); Sodium Lactate (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µM sodium selenite (Sigma-Aldrich), 2.5 mg/mL insulin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...