Labshake search
Citations for Millipore Sigma :
7401 - 7450 of 10000+ citations for 6 Ethyl 1H indole 2 3 dione 3 O 4 4 4 trifluoro butyl oxime since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma) was used to eliminate dead cells ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma). Slides were mounted with Elvanol mounting medium.
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma) or fixable viability dye 405 (eBiosciences) ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma) and Alexa488 Streptavidin (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma). Flow cytometry was performed on a MACSQuant Analyzer 10 (Miltenyi Biotec) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamino-2-phenylindole (DAPI) (Sigma) in PBS for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... The mould was treated with Trichloro(1H,1H,2H,2H perfluorooctyl)silane (Sigma) in vacuum overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... and subsequently with 1H,1H,2H,2H-perfluoro-1-octanol (PFO, Sigma-Aldrich) to destabilise the droplet interface and break the emulsion ...
-
bioRxiv - Biophysics 2021Quote: ... After exposure to vapor of trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma) for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Next, a treatment of trichloro (1H, 1H, 2H, 2H-perfluorooctyl)silane (Millipore Sigma) was applied to the surface of the 3D piece to make it inert and to facilitate the next step of casting ...
-
bioRxiv - Neuroscience 2019Quote: ... after which 10 μM 6-TG (6-thioguanine or 2- amino-6-mercaptopurine, Sigma-Aldrich) with 200 μg/ml G418 selection was carried out for an additional 6-8 days ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 5 M tert-butyl hydroperoxide (TBHP) (Sigma Aldrich, United States) were prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2021Quote: ... NPCs were exposed to tert-butyl hydroperoxide (TBHP; Sigma-Aldrich, USA) for in vitro induction of oxidative stress.
-
bioRxiv - Cell Biology 2021Quote: ... with the addition of methyl tert-butyl ether (MTBE) (Sigma Aldrich) and methanol (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... tert-butyl hydroperoxide (tBOOH 70% w/w in H2O, Sigma 458139) was diluted directly into the SC medium ...
-
bioRxiv - Microbiology 2023Quote: ... and methyl tert-Butyl ether (MTBE) were purchased from Sigma-Aldrich Chemie NV (Zwijndrecht ...
-
bioRxiv - Biochemistry 2020Quote: ... sodium pyruvate (P; 1 mM) and octanoic acid (O; 2 mM) (Sigma, Gillingham, UK).
-
bioRxiv - Biochemistry 2020Quote: ... sodium pyruvate (P; 1 mM) and octanoic acid (O; 2 mM) (Sigma, Gillingham, UK) for a period of 48 h ...
-
bioRxiv - Plant Biology 2019Quote: ... hand-cut sections were stained for 2 min using Toluidine Blue O (Sigma-Aldrich) and 1 min using phloroglucinol blue (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... sgRNAs with stabilizing 2’-O-methyl and phosphorothioate linkages were ordered from Sigma-Aldrich or Synthego ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg of protein from each sample were incubated with 3 ug of HOXA9 (Millipore # 07-178) or Rabbit IgG Isotype control (Invitrogen # 02-6102 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lung tumors were induced in 6-8 weeks old mice by intraperitoneal injection of 8 doses of 1 g/kg of urethane (ethyl carbamate; Sigma); second dose was given 48h after the initial one and then once a week to reach a total of 8 doses ...
-
bioRxiv - Plant Biology 2023Quote: ... tubes were filled and replenished with a solution of 1 x 10-5 M abscisic acid (2-cis,4-trans-Abscisic Acid, 98%; Sigma-Aldrich; St. Louis MO, USA; product 862169). For the FC experiment ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The plates were incubated for two hours at RT and 2,2′-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) substrate solution (Sigma-Aldrich, USA) was added for colour development ...
-
bioRxiv - Neuroscience 2021Quote: ... Each well of 6-well cell culture treated plates coated with 0.1% Poly-L-ornithine (3 ug/mL; Sigma Aldrich, P4957) were seeded with ∼750K cells and maintained with sterile-filtered neurobasal medium (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: HBP inhibition in vivo was achieved by treatment of tumor bearing mice with 3 doses (10 mg/kg) of DON (6-Diazo-5-oxo-L-norleucine, Sigma-Aldrich) every 3 days ...
-
bioRxiv - Microbiology 2020Quote: ... Transverse sections (6 µm) were sectioned and mounted on silane-covered (TESPA, 3-aminopropyl-triethoxysilane, Sigma-Aldrich, St. Louis, Missouri, USA) glass slides ...
-
bioRxiv - Microbiology 2019Quote: The Nafion films on the IDAs mounted in the Teflon cell were loaded with various amounts of Ru(NH3)6 3+ by either exposing the films to a 10 mM solution of Ru(NH3)6Cl3 (Sigma Aldrich) in 0.2M Na2SO4 at time points from several minutes to several hours or by allowing Ru(NH3)6 3+ in the films to diffuse out into bulk electrolyte for several hours ...
-
bioRxiv - Genomics 2020Quote: ... transfected in the Lonza 4D nucleofector program ‘CA-137’and seeded onto a Matrigel-covered 6-well plate in 3 ml StemFlex containing 10 μM Thiazovivin (Millipore, #S1459). The cells were subjected to a 48 hour cold shock at 32 °C to enhance homology directed repair (HDR) ...
-
bioRxiv - Biochemistry 2022Quote: ... Sample was then concentrated 6 times by ultrafiltration using a 3 kDa molecular weight cut off Centricon centrifugal filter units (EMD Millipore) and applied onto a Superdex 200 10/300 increase (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... cells seeded in 12-well plates were pre-treated with 500 mU/mL α2-3/6/8 sialidase from Clostridium perfringens (Sigma-Aldrich) for 3 hours at 37°C before infection ...
-
bioRxiv - Bioengineering 2022Quote: ... cell-laden microgels were demulsified and resuspended by an excessive amount of LB media spiked with 10−6 mol/L 3-Oxo-C12-HSL (Sigma-Aldrich) before incubation at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: Acellular stretched and nonstretched hydrogels in 3 mg/mL and 6 mg/mL concentrations were created and fixed in 3.7% formaldehyde (Sigma-Aldrich 252549) in PBS at room temperature for 1 hour ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 M Urea and 1% Sodium Dodecyl Sulphate supplemented with 100mM phenylmethylsulfonyl fluoride and 1% phosphatase inhibitor cocktail 3 (Sigma-Aldrich)) ...
-
bioRxiv - Microbiology 2021Quote: ... Three subsamples (∼2 ml) were taken from each section with a 3 ml syringe and immediately fixed in 2 ml RNAlater (Sigma Life Science) in a 5 ml tube (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt, Aldrich) or negatively charged 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS, Sigma-Aldrich, Inc) containing N,N’-methylenebisacrylamide (Sigma ...