Labshake search
Citations for Millipore Sigma :
7301 - 7350 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were transfected with 1.2 µg DNA (total) per 3 µL GeneJuice (Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Larvae were anesthetized with 160 mg/L of ethyl 3-aminobenzoate methanesulfonate (MS222; Sigma-Aldrich). A 15 seconds video of each larva in the lateral position was then captured ...
-
bioRxiv - Molecular Biology 2019Quote: ... Resumption of meiosis was prevented with 0.2 mM 3-isobutyl-1-methyl-xanthine (IBMX, Sigma). MII oocytes were obtained from animals superovulated with 7 IU of PMSG administered on day 1 and 7 IU of hCG administered 46 – 48 h post PMSG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were harvested (5,000 x g; 20 min; 4°C; Sigma 3-16KL; rotor 11180); the spent medium was TCA-precipitated (20% w/v ...
-
bioRxiv - Physiology 2020Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP; Sigma-Aldrich, Gillingham, UK) substrate solution (50 mg/ml BCIP in autoclaved water ...
-
bioRxiv - Microbiology 2020Quote: ... with a 3 kDa molecular weight cut-off ultrafiltration disk (Millipore Sigma; Cat. No.: PLBC06210)] and then dialyzed extensively against water [3.5 kDa molecular weight cut-off dialysis tubing (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and zebrafish larvae were treated with chloroquine diphosphate (3 mM, Sigma-Aldrich [catalogue number C6628]), two commonly utilised inhibitors of autophagy [32] ...
-
bioRxiv - Physiology 2021Quote: ... They were then given access to bottles with water containing 3% sucrose (Sigma-Aldrich #16104) or pure water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Standard samples of 3-oxo-C12-HSL and C4-HSL were purchased from Sigma-Aldrich. The cell-free reaction samples were preprocessed using HPLC (Supplementary Methods) ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were harvested by trypsinisation in 3 ml 0.25% trypsin-EDTA solution (Sigma-Aldrich, T3924), which was then inhibited by adding 4 ml of ice-cold KHM buffer (110 mM KOAc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 12.5 µl of 3 mM 4- methylumbelliferyl N-acetyl-β-D-glucosaminide (Sigma-Aldrich) followed by incubation for 30 min at 37°C ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... brain slices were blocked in a solution containing 3 % donkey serum (DS) (D9663, Sigma-Aldrich) and 0.3 % Triton X-100 (T ...
-
bioRxiv - Biochemistry 2021Quote: ... The 3’ biotinylated TAR and RNA 30-mer (Table 1) were chemically synthesized (Sigma Aldrich). RNA (50 pmol ...
-
bioRxiv - Neuroscience 2021Quote: DIV 3 hippocampal neurons were treated with 1μM of (+)-MK-801 hydrogen maleate (Sigma, M107) for 30 min at 37ºC to reduce spontaneous rod formation ...
-
bioRxiv - Neuroscience 2021Quote: DIV 3 hippocampal neurons were treated with 1μM of (+)-MK-801 hydrogen maleate (Sigma, M107) for 30 min at 37ºC to reduce spontaneous rod formation ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... the 3:1-DMEM/F12-medium was supplemented with 10 μM retinoic acid (Sigma, #R2625), and the medium was daily exchanged ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 0.1% 2-mercaptoethanol) containing 10 µM SB431542 (R&D) and 3 µM CHIR99021 (Sigma), and was subsequently replaced every day ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then washed with PBS and incubated with blocking buffer containing 3% BSA (Sigma) at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Cell Biology 2021Quote: ... coated tissue culture dishes and routinely sub-cultured every 2–3 days using accutase (Sigma) for detachment ...
-
bioRxiv - Immunology 2020Quote: ... Cells were resuspended in flow cytometry buffer (FB: 2% FCS, 3 nM EDTA (Sigma, E9884) in PBS) ...
-
bioRxiv - Microbiology 2020Quote: ... Endogenous peroxidase activity was inhibited using 3% H2O2 in molecular-grade methanol (Sigma-Aldrich, Germany). Slides were washed with phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2021Quote: ... or 400µg NP-PCC (4-hydroxy-3-nitrophenylacetyl (Biosearch) conjugated to pigeon cytochrome C (Sigma)) mixed with adjuvant based on Monophosphoryl Lipid A ...
-
bioRxiv - Microbiology 2020Quote: ... mouse splenocytes were plated at 3 × 105 / well into 96-well filtration plates (Millipore, USA) pre-coated with capture antibodies and stimulated with 5 µg / well purified JEV or ZIKV particles for 60 h at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... The DRG cells were then passed over a 3% bovine serum albumin (BSA) (Sigma-Aldrich) gradient and resuspended in Neurobasal-A medium (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... Following enzymes were blocked Histone acetyltransferases by epigallocatechin-3-gallate (EGCG; 15 µM; Sigma-Aldrich), histone methyltransferases by 5′-deoxy-5′-methylthioadenosine (MTA ...
-
bioRxiv - Immunology 2021Quote: ... The plates were developed with commercially available 3-Amino-9-ethylcarbazole (AEC) substrate (Sigma-Aldrich). The observed spots were counted using an ELISPOT plate reader by ZellNet and the final data was reported as spot forming cells (SFC ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3 days and expanded prior to seeding into triple flasks (Nunc® Sigma-aldrich). Expression was induced with 1 μg mL-1 doxycyclin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated for 20 min in blocking buffer: PBS 3% BSA (Sigma, A4503), incubated for 1 h with H3PS10 antibody (1/1000) ...
-
bioRxiv - Cell Biology 2021Quote: ... They were then washed three times in PBS before blocking in 3% BSA (A8806; Sigma) in PBS for 1 hour ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-isobutyl-1-methyl xanthine and poly-lysine were from Sigma Aldrich (St Louis, MO). All other reagents were of analytical grade.
-
bioRxiv - Bioengineering 2021Quote: ... Amicon® Ultra-15 Centrifugal Filter Units (3 kDa MWCO) were purchased from Millipore Sigma. Atsttrin was supplied by Synermore Biologics Co. ...
-
bioRxiv - Neuroscience 2021Quote: ... Germany) was treated with hexam-ethyldisilazane (HMDS) (CAS number: 999-97-3, Sigma-Aldrich, Germany) and dehydrated at 125°C to enhance adhesion to its surface ...
-
bioRxiv - Biophysics 2021Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were procured from Sigma Aldrich, St ...
-
bioRxiv - Microbiology 2021Quote: ... Calu-3 stocks were additionally cleared using a 0.45 μM low protein binding filter (Millipore) to remove mucus debris produced by these cells and the medium was exchanged three times for Opti-MEM I (1X ...
-
bioRxiv - Neuroscience 2020Quote: ... Mice in the MOD groupreceived bilateral infusions of STZ (Sigma-Aldrich, s0130; 3 mg/kg) dissolved in 0.9% sterile saline into the hippocampus on both coordinates with a constant rate (500 nL/min ...
-
bioRxiv - Cell Biology 2020Quote: ... enteroid monolayers were maintained in OBM supplemented with 3 μM CHIR-99021 (Sigma Aldrich #SML1046), 50 ng/mL murine EGF (Invitrogen #PMG8043) ...
-
bioRxiv - Microbiology 2022Quote: ... and 2-Heptyl-3-hydroxy-4(1H)-quinolone (pqs, Sigma-Aldrich CAS# 108985-27-9) alone and in combination ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were washed once with 1X PBS containing 3% BSA then stained with DAPI (Sigma) for 10’ at room temperature and visualized.
-
bioRxiv - Cell Biology 2022Quote: ... Sections were incubated with 3% hydrogen peroxidase (Sigma-Aldrich, St. Louis, MO, H1009, 1:10) for 20 min and incubated with a blocking reagent (Vector Laboratories ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viability was examined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay (Sigma). The absorbance was measured using a Synergy™ 4 plate reader (Bioteck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and incubated with enzymatic digestion solution containing 3 mg/ml collagenase A (Sigma Aldrich, 11088793001) and 70 unit/ml DNase in RPMI 1640 (Biological industries ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen scaffolds were crosslinked with N-(3-Dimethylaminoproypl)-N-ethylcarbodiimide hydrochloride (EDC) (E1769, Sigma-Aldrich) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Biophysics 2022Quote: Emulsions were made by adding 3% (v/v) extract mix to degassed mineral oil (Sigma) containing 4% cetyl PEG/PPG-10/1 dimethicone (Abil EM90 ...
-
bioRxiv - Cell Biology 2022Quote: ... then immersed in 100% ethyl-3-phenylprop-2-enoate (ethyl cinnamate [ECi]) (W243000, Sigma-Aldrich) and finally kept at room temperature until subsequent imaging step.
-
bioRxiv - Cell Biology 2022Quote: ... MTT reagent [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma-Aldrich, St. Louis, MO), dissolved in PBS ...
-
bioRxiv - Genomics 2022Quote: The plant auxin analog Indole-3-acetic acid (IAA) sodium salt (Millipore Sigma, Cat. I5148) was dissolved in ddH2O with a stock concentration of 500mM ...
-
bioRxiv - Genomics 2022Quote: ... slides or coverslips were first incubated in block buffer (3% BSA (Sigma Aldrich, A7906-50G), 0.1% Triton-X-100 (Sigma ...
-
bioRxiv - Genetics 2022Quote: ... and washed with PBST 3 × 10 min before proteinase K (Sigma-Aldrich, cat. no. 39450016) treatment for 5 min at room temperature ...