Labshake search
Citations for Millipore Sigma :
651 - 700 of 1463 citations for Non Ab Component of Alzheimer's Disease Amyloid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-phospho-Histone H2A.X (Ser139)(abcam ab 2893 and Merck Millipore, JBW301), phospho-RPA2 (Ser33 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-Calb primary Ab (1:1000; Sigma Aldrich, Cat# C9848, RRID:AB_476894) and Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit anti-GAD primary Ab (1:500, Sigma-Aldrich, Cat# G5163, RRID:AB_477019) and Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-Calb primary Ab (1:1000; Sigma Aldrich, Cat# C9848, RRID:AB_476894) and Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-Calb primary Ab (1:1000; Sigma Aldrich, Cat# C9848, RRID:AB_476894) and Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 penicillin/streptomycin and 10% male human AB serum (Sigma-Aldrich) (“T-cell medium”) ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were then incubated overnight at 4 ° C using antibodies specific for the N-terminal amino acids 66 – 81 of the amyloid precursor protein (APP) (Millipore, Burlington MA, clone 22C11 at 1:80K), GFAP (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... individual components can be added to 500 ml media bottle at the indicated final concentrations: 1) Recombinant Human Insulin (Sigma I-1882) – 12.5 µg/ml final concentration ...
-
bioRxiv - Physiology 2022Quote: ... glycerol and triglyceride levels in each sample were measured using a Serum Triglyceride Determination Kit (Sigma-Aldrich, components F6428, T2449, and G7793) and normalized to protein levels (BCA Protein assay ...
-
bioRxiv - Bioengineering 2023Quote: Genes for the sensor components (QBP, mCherry, NanoBiT, and other PBPs with nucleotide sequences complementary to pET21a and Novagen at both ends) were synthesized by IDT gBlocks® Gene Fragments (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... received a non-target shRNA viral injection (NT-shRNA; SHC016: MISSION® pLKO.1-puro non-Target shRNA Control Plasmid DNA; Sigma Aldrich, St. Louis, MA, USA) to determine any effects of surgery alone on respiratory behaviour ...
-
bioRxiv - Cell Biology 2019Quote: ... The anti-LC3B and the anti-GAPDH Abs were purchased from SIGMA-ALDRICH (reference L7543 and G9295 ...
-
bioRxiv - Neuroscience 2022Quote: ... The antibody used was an anti-TH diluted 1:500 (AB-152, Millipore). After over-night incubation with the primary antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... slides were stained by Alcian Blue (AB) solution pH 2.5 (Sigma, MO, USA) followed by Periodic acid-Schiff staining (kit #395B ...
-
bioRxiv - Immunology 2022Quote: ... media was replenished with RPMI containing 5% type AB human serum (Sigma-Aldrich). For single-round experiments with VSV-G-pseudotyped viruses ...
-
bioRxiv - Immunology 2021Quote: ... cells were resuspended in PBS with 2% Human Heat Inactivated AB Serum (Sigma) and 0.1 M EDTA pH 8.0 (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-ICP4 MAb H1A021 or monoclonal Ab to VSV glycoprotein G (P5D4, Sigma) was added for 1 h followed by Alexa Fluor 488-labeled goat anti-mouse IgG (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DMEM (without phenol red) and human male AB serum were from Sigma-Aldrich Chemie GmbH (Munich ...
-
bioRxiv - Molecular Biology 2021Quote: ... or proinsulin Ab (CCI-17) bound protein G beads (GE17-0618-01, Sigma) for overnight at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... or peroxidase-conjugated anti-mouse IgG (Fab Specific) Ab (Sigma A2304; 1:200’000). The immuno-positive bands were visualized by chemiluminescence using the WesternBright ECL-HRP Substrate (Witec AG) ...
-
bioRxiv - Immunology 2020Quote: ... cells were resuspended in PBS with 2% Human Heat Inactivated AB Serum (Sigma) and 0.1M EDTA pH 8.0 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... Opsonization of iRBCs was performed by culturing iRBCs with AB human serum (Sigma) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse IgG HRP linked whole Ab (Sigma; #NA931-1ML, 1:5000; lot #: 17041904), and Rabbit IgG HRP linked whole Ab (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10 % human serum (male AB, H6914-100ml Batch SLBT2873, Sigma-Aldrich), 1 % penicillin/streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... and 10% human serum (heat-inactivated, sterile-filtered, male AB plasma; Sigma-Aldrich). Adaptive NK cell-positive donors were identified by anal-ysis of NKG2C (FAB138P or FAB138A antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% MEM non-essential amino acid solution (NEAA; Sigma-Aldrich #M7145), 10 ng/mL human recombinant BDNF (Promokine #C66212) ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 1x MEM Non-essential Amino Acid Solution (Sigma-Aldrich), 10 % v/v fetal bovine serum (FBS) ...
-
bioRxiv - Systems Biology 2020Quote: ... containing 1% non-autologous human plasma (Sigma-Aldrich, St Louis, USA), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... under non-reducing conditions and transferred onto PVDF membranes (Sigma Aldrich). After 1 hour blocking in 5% non-fat milk solution (Bio-Rad 170-6404 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% non-essential amino acids and 0.1 mM 2-mercaptoethanol (Sigma) for EB formation ...
-
bioRxiv - Microbiology 2022Quote: ... The following shRNAs were used: Non-Targeting Control shRNA (Sigma, SHC002), EIF4E2 shRNA#1 (sh4EHP#1 ...
-
bioRxiv - Biochemistry 2022Quote: ... were obtained from IDT and non-labelled template oligonucleotides from Sigma. The substrates were made by mixing equal amounts of primer and template oligos (300pM ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% MEM non-essential amino acid solution (NEAA; Sigma-Aldrich #M7145), 10 ng/mL human recombinant BDNF (Promokine #C66212) ...
-
bioRxiv - Cell Biology 2019Quote: ... Non-treated cells (vehicle only, containing 0.1% endotoxin free BSA, Sigma) served as controls for each experiment ...
-
bioRxiv - Cell Biology 2019Quote: ... or non-target controls (SHC202) (CCGGCAACAAGATGAAGAGCACCAACTC) and (TRCN0000158395; CCTACAGTGGATGTCCTACAT) (Sigma Aldrich). The transduced cells were selected in media containing 1 ug/ml puromycin for 6 days ...
-
bioRxiv - Bioengineering 2019Quote: ... antibiotics and 1% non-essential amino acids (all from Sigma-Aldrich). Fibroblasts grew from the fragments within 3-4 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were detached using non-enzymatic cell dissociation solution (Sigma Aldrich) when they reached 80 % confluence ...
-
bioRxiv - Neuroscience 2020Quote: ... A non-targeting shRNA (# SHC202) was also purchased from Sigma-Aldrich.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1.1 mM of MEM non-essential amino acid 100X (Sigma, USA), 1 ng/ml of ovine FSH (Sigma ...
-
bioRxiv - Bioengineering 2019Quote: ... 1% minimum essential medium non-essential amino acid solution (Sigma-Aldrich), 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Genetics 2020Quote: ... 0.1mM non-essential amino acids and 0.1mM 2-mercaptoethanol (Sigma-Aldrich), before being plated onto 0.1% gelatin-coated cover slips ...
-
bioRxiv - Cell Biology 2020Quote: ... The PVDF membrane was blocked with 5% non-fat milk (Sigma) in 1x PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% MEM Non-essential Amino Acid Solution (M7145, SAFC Sigma-Aldrich) and 200 μM L-ascorbic acid phosphate magnesium salt (013-19641 ...
-
bioRxiv - Cancer Biology 2020Quote: ... controls pLKO (SHC001, no insert) and non-mammalian shRNA (Sigma; SCH002) in 293T cells using the third-generation lentiviral packaging system (10,11) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2% (w/v) glucose (non-inducing) or galactose (inducing) (Sigma), then the media were adjusted to pH 4.2 with 10 mM citric-Na3Citrate buffer (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... All caloric and non-caloric sugar ligands were purchased from Sigma and dissolved in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the CRISPR-lenti lentiviral vector Non-directed control plasmid (Sigma-Aldrich) was used ...
-
bioRxiv - Microbiology 2022Quote: ... under non-reducing conditions and transferred onto PVDF membranes (Sigma Aldrich). After 1 h blocking (5% non-fat milk ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with non-essential amino acids (1×; #M7145, Sigma-Aldrich, USA), 1 mM sodium pyruvate (#S8636 ...
-
bioRxiv - Cell Biology 2022Quote: ... Caspase-1 non-permeable (Cat # 400010) inhibitor was obtained from Millipore and used at a concentration of 10μM ...