Labshake search
Citations for Millipore Sigma :
651 - 700 of 3268 citations for GDF 11 BMP 11 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10% human serum (Sigma) and antibiotics-antimycotic (1x ...
-
bioRxiv - Immunology 2023Quote: ... and 0.6 µl human serum (Sigma). After two washes with CyFACS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ug/ml human insulin (Sigma), 10 nM hydrocortisone (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 nM human insulin (Sigma-Aldrich), 25 nM dexamethasone ...
-
bioRxiv - Microbiology 2023Quote: ... and human (AB serum, Sigma-Aldrich) for 15 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... apo-transferrin (apo-transferrin human, Sigma), ferritin (equine spleen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-human Tubulin (T6074, Sigma) at 1:10 000 (WB ...
-
bioRxiv - Cell Biology 2023Quote: ... Human bronchial epithelial cells (16HBE14o-, Sigma) were maintained in medium consisting of α-MEM (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% human AB serum (Sigma-Aldrich) and 25 ng/mL IL-2 (Miltenyi Biotec) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:2000 human anti-CREST (Sigma) and donkey anti-human Dylight550 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-human-CEBPα (Sigma Aldrich, HPA052734) and the secondary antibody (HPR anti-mouse ...
-
bioRxiv - Bioengineering 2023Quote: ... rabbit anti-human Oct4 (Millipore, US), and rabbit anti-human HSP90 (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 1 % human albumin (Sigma). PBMC were thawed and rested overnight in X-Vivo-20 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% human AB serum (Sigma-Aldrich), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human P2RY12 (Sigma, HPA014518), rabbit anti-human PU.1 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... Insulin solution human (Sigma Aldrich, I9278);
-
bioRxiv - Biochemistry 2024Quote: ... human Glu-Fibrinopeptide B (Sigma-Aldrich) was recorded throughout the analysis for lock-mass calibration ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant human TNFα (Sigma Aldrich, #H8916), PGE2 (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... thrombin from human plasma (Sigma-Aldrich) and GelMA (8.7% w/v) ...
-
bioRxiv - Pathology 2024Quote: ... and 0.5mg human fibrinogen (Sigma-Aldrich) in a total volume of 100µL EHT culture media (Celo.Cardiomyocyte advanced culture media ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Bioengineering 2024Quote: IgG from human serum (Sigma-Aldrich) was incubated at 62°C for 30 min to induce aggregation ...
-
bioRxiv - Bioengineering 2024Quote: ... or human complement C1q (Sigma-Aldrich) were immobilized on a CM5 or C1 sensor chip (Cytiva ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 mg/mL human fibrinogen (Sigma), 10% Matrigel (Corning) ...
-
bioRxiv - Cancer Biology 2024Quote: ... raised against human ST3GAL1 (Sigma HPA040466) and ST3GAL2 (Abcam ab96028) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10nM recombinant human gastrin (Sigma; G9145), 5ng/mL recombinant human HGF (PeproTech ...
-
bioRxiv - Microbiology 2024Quote: ... 10 % human AB serum (Sigma-Aldrich), and 10 ng/ml recombinant human macrophage colony stimulating factor (Peprotech ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% human serum albumin (Sigma-Aldrich), 0.0002% heparin (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cells were seeded in 6-well plates (3.0 × 105 cells/well) coated with poly-L-lysine (Sigma-Aldrich, St. Louis, MO, USA) and incubated for 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Then, wildtype HEK293 cells (ATCC, CRL-1573) were infected in regular growth medium with 5 µg/mL polybrene (Sigma-Aldrich, TR-1003-G) and the lentivirus at a multiplicity of infection of 5 viral particles per cell ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids of Cypridina noctiluca luciferase and Omicron RBD or its mutants were co-transfected (9:1) into HEK293 cells using X-tremeGENE 9 (Millipore-Sigma XTG9-RO). After 16 hours ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Genetics 2022Quote: ... Human Erythroleukemia (HEL) and human TF-1 cells were cultured in RPMI-1640 medium (Sigma Aldrich #R8758) supplemented with 10% Fetal Bovine Serum (Sigma Aldrich #F0926 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte- human fibrinogen mixture (Sigma-Aldrich). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte-human fibrinogen mixture (Sigma-Aldrich) and 2µL of the mixture is carefully pipetted into the microwell ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293-T cells were transiently transfected with GFP-V5 or GREP1-V5 fusion proteins using OptiMem and Fugene HD (Sigma-Aldrich, St. Louis, MO). 72 hours after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Bioengineering 2019Quote: ... Lyophilized proteins were purchased: human serum albumin (HSA; from human plasma, ≤0.02% Fatty acids, Lot #SLBZ2785, Millipore Sigma) and fibrinogen (FBG ...
-
bioRxiv - Biochemistry 2021Quote: Lyophilized human haptoglobin phenotype 1-1 (Hp) and human α,β haemoglobin (Hb) were purchased from Sigma Aldrich. Deglycosylation enzyme PNgase F was from New England BioLabs Inc ...
-
bioRxiv - Biophysics 2021Quote: PAI-1 (human recombinant, Sigma-Aldrich, Germany)
-
bioRxiv - Biophysics 2021Quote: Fibrinogen (human plasma purified protein, Sigma-Aldrich)
-
bioRxiv - Biophysics 2021Quote: ... PAI-1 (human recombinant, Sigma-Aldrich, Germany), Plasminogen (human plasma purified protein ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant human thrombin (1 U/ml, Sigma) was added to the bottom of a 3.0 µm costar polycarbonate transwell membrane insert (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... sativa–derived recombinant human albumin (Sigma-Aldrich), and 213μg/ml L-ascorbic acid 2-phosphate (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... 10μM recombinant human Gastrin (Sigma-Aldrich G9145), 50ng/mL recombinant human HGF (Peprotech 100-39H) ...