Labshake search
Citations for Millipore Sigma :
6751 - 6800 of 10000+ citations for 6 Ethyl 1H indole 2 3 dione 3 O 4 4 4 trifluoro butyl oxime since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 8-acetyl-6,11-dihydroxy-7,8,9,10-tetrahycro-napthacene-5,12-dione (R162892, Sigma Aldrich). 15N racemic and R-(+)-lipoamide were synthesised (see Supplementary Information ...
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Neuroscience 2019Quote: ... embedded with sucrose 30% for 3 days and finally frozen in 2-methylbutane (Sigma-Aldrich, France) at −80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were next incubated with 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Sigma-Aldrich M5655) for 4h followed by formazan crystal solubilization with isopropanol and absorbance readings at OD570 (Kumar et al. ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 were obtained from Sigma-Aldrich (St. Louis, MO, USA). The secondary fluorescent antibody Alexa Fluor 488 (goat anti-mouse ...
-
bioRxiv - Molecular Biology 2022Quote: The 3-(4,5-dimethylthiazol-2-ul)-2,5-diphenyl tetrasodium bromide (MTT, Sigma-Aldrich, St. Louis, MO) cytotoxicity assay measures mitochondrial reductases ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2022Quote: ... Selection was initiated after 2-3 days with 25-150μg/ml of Hygromycin B (Sigma-Aldrich) and maintained for 10-15 days ...
-
bioRxiv - Cancer Biology 2024Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 0.5 mg/mL 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, Sigma, USA) for 4 hrs at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... Phalloidin and MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Sigma Aldrich. DMEM (Dulbecco’s Modified Eagle’s Medium) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated for 3 hours in 100 μl of 2% acrylamide (AA; A4058, Sigma-Aldrich) + 1.4% formaldehyde (FA ...
-
bioRxiv - Microbiology 2023Quote: ... and tissues digested in 3 mL complete HBSS-2 containing 0.5 mg/mL Collagenase-D (Sigma) at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium) reagent and paraformaldehyde were purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Cancer Biology 2023Quote: Cellular proliferation was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT; Sigma) assay and validated by viable cell counts.80
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability was assessed using MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Sigma-Aldrich). 10μl MTT (5 mg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Bioengineering 2022Quote: ... USA) and subsequently submerged in a solution of 2% bis[3-(trimethoxysilyl)propyl]amine (Sigma-Aldrich), and 1% DI-water in IPA at 80°C for 20 minutes following previously published protocols 67 ...
-
bioRxiv - Microbiology 2023Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-(4,5 dimethylthiazol-2-tl)-2,3-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (STL, USA). Bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Biophysics 2024Quote: ... cell viability was determined using 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich) as described previously.[9 ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5 mM EDTA) supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma- Aldrich, P5726 and P0044) and protease inhibitor cocktail (6 μg/ml chymostatin ...
-
bioRxiv - Plant Biology 2024Quote: ... 300 μM of [3-(2-pyridyl)-5,6-diphenyl-1,2,4-triazine sulfonate] Ferrozine (Sigma-Aldrich, Bangalore, India) was added in -Fe media ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by the addition of 60 µL NADPH (N7505, Sigma; 2 mg/3 mL assay buffer). The formation of TNB was monitored kinetically at 412 nm over 5 min in a spectrophotometer (Fluostar Omega ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.3% CHAPS) supplemented with Phosphatase Inhibitor Cocktail 2 and Cocktail 3 (Sigma-Aldrich, P5726 and P0044) and Complete Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Microbiology 2019Quote: ... EVs were incubated with Gal-3 (Gal-3 human recombinant, expressed in E. coli, Sigma-Aldrich) at different final concentration (0 to 10 µg/ml) ...
-
bioRxiv - Plant Biology 2021Quote: ... Roots samples were vacuum infiltrated with 3-3’-diaminobenzidine tetrahydrochloride (1.25 mg/mL, DAB, Sigma-Aldrich), Tween-20 (0.05% v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... sections were washed 3 times with 0.01% PBS-T and DAPI (Sigma-Aldrich, #28718-90-3) nuclear stain ...
-
Fine tuning of CpG spatial distribution with DNA origami for improved therapeutic cancer vaccinationbioRxiv - Synthetic Biology 2023Quote: ... 3’-3’ linkage of CpG with some staples were applied by dibenzocyclooctyne (DBCO)-azide (Sigma, US) click chemistry (Fig ...
-
bioRxiv - Bioengineering 2023Quote: ... gels were washed 3 times x 5 minutes with a 3% Bovine Serum Albumin (BSA, Sigma) blocking solution in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... blocked for one hour in blocking buffer (3% goat serum and 3% BSA in PBS (Sigma)) and incubated with pneumococcal antisera Pool Q (SSI Diagnostica ...
-
bioRxiv - Immunology 2021Quote: Blood was extracted from hBLT mice at 3 and 5-6 weeks post-infection and lysed with Red Blood Cell Lysis Buffer (SIGMA). T cells were activated for 1.5 h with 5μl/ml of anti-CD28 and anti-CD49d in the presence or absence of 6.4μg/ml of a Gag pool of peptides in the presence of 0.5μg/ml Brefeldin A ...
-
bioRxiv - Bioengineering 2019Quote: Cy3-(GT)6-SWCNTs and Cy3-(GT)30-SWCNTs were first filtered 3 times using 100kDa Amicon centrifuge filters (Millipore) to remove free Cy3-DNA from solution ...
-
bioRxiv - Bioengineering 2019Quote: ... Laccase activity was followed by the oxidation of 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) (Sigma-Aldrich, USA) (33) ...
-
bioRxiv - Biochemistry 2019Quote: ... 3 mM KCl) and harvested in a PBS lysis buffer (PBS plus 6 uL/mL protease inhibitors cocktail (Sigma P8340), 0.6 mM PMSF ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mL volumes of culture were transferred per well to 6-well tissue culture-treated polystyrene plates (Sigma CLS3506) and incubated at 23°C for 48 hours ...