Labshake search
Citations for Millipore Sigma :
6551 - 6600 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... plus 20 μl 2-mercaptoethanol (Sigma cat. no. 60-24-2) then frozen at – 80C.
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM 6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Sigma, 238813), 250 µg/ml glucose oxidase (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.1 M 2-Deoxy-Glucose (2-DG; Sigma Aldrich #D8375-1G)37 ...
-
bioRxiv - Zoology 2023Quote: ... Each egg-sperm bundle was placed in a 2 mL microcentrifuge tube and allowed to break up in 0.1 mL of seawater and for the eggs to hydrate for 2 hrs before preserved in zinc fixative (1:4 Z-fix, Sigma-Aldrich Inc. to 0.2 µm filtered seawater FSW). Preserved eggs from each bundle were photographed using an Olympus SZX7 dissecting microscope equipped with an Olympus America camera (SN ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Cell Biology 2020Quote: ... R-spondin 3 and Noggin were selected during the 3 first days post seeding by adding 0.5 mg/mL G418 (Sigma-Aldrich) and 0.5 mg/mL Hygromycin B (InvivoGen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Osteogenic differentiation was performed in osteogenic medium (Cyagen, GUXMX-90021) for 3 weeks (medium was changed every 3 days) and quantified by alizarin red staining (Sigma) and qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Brain slices containing the ZI slices were first washed (3×3 mins) with 1X Tris-buffered saline (TBS) (Sigma Aldrich) with 0.1% Tween-20 (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: Midbrain or DMS-containing slices were washed (3×3 mins) with 1X Tris-buffered saline (TBS) with 0.1% Tween-20 (Sigma Aldrich), permeabilized (20mins ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then washed with PBS and treated with DAB solution (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 0.06% H2O2) for visualization ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were further washed with TBS and treated with DAB solution for 20 minutes (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 2.5% Nickel Sulphate Hexahydrate, Sigma+0.06% H2O2) for color development and visualization ...
-
bioRxiv - Bioengineering 2020Quote: ... and immersed in modified Karnovsky’s fixative (2% w/v glutaraldehyde and 3% w/v PFA in 0.1 M sodium cacodylate buffer containing 5mM CaCl2 and 3% sucrose, all from Sigma-Aldrich) for 1 h at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... TAK242 in which mice were subjected to TBI and treated with the TLR4 inhibitor TAK242 diluted in saline containing 3% DMSO (3 mg·kg−1; Sigma-Aldrich). TAK242 or saline were i.p ...
-
bioRxiv - Cell Biology 2022Quote: ... glass coverslips were etched homogenously with a 0.1 M NaOH solution for 3 min and then treated with 3-(trimethoxysilyl)propyl methacrylate (cat. no. 440159, Sigma-Aldrich) to introduce amine groups to cross-link with the polyacrylamide hydrogel ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Fixed embryos were washed with 3%HCl/70%EtOH solution for 3 times and stained in 1% Victoria blue B (Sigma) dissolved in 3%HCl/70%EtOH overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The amine reactive second-generation (AR2G) biosensors were processed with 1-ehtyl-3-(3-dimethylaminopropy) carbodiimide hydrochloride (EDC, E1769, Sigma) and sulfo-N-hydroxysulfosuccinimide (s-NHS ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mm ID × 150 mm, 3-μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate / water ...
-
bioRxiv - Bioengineering 2023Quote: Liposomal NPs encapsulating MRX-2843 or venetoclax were made by first mixing organic solutions of DSPC (1,2-distearoyl-sn-glycero-3-phosphocoline; NOF Corporation, Shanghai, China), DSPG (1,2-distearoyl-sn-glycero-3-phosphoglycerol, sodium salt; NOF) and cholesterol (Sigma-Aldrich) lipids together at a 7:2:1 mol:mol ratio ...
-
bioRxiv - Cell Biology 2023Quote: ... Dried extracts were phase-separated using -20°C LCMS-grade chloroform/methanol/water (1:3:3, v/v) (Sigma Aldrich).
-
bioRxiv - Plant Biology 2023Quote: Leaf disks (3 mm) of Arabidopsis thaliana and Nicotiana benthamiana were fixed with 3% (w/v) glutaraldehyde (Sigma, Taufkirchen, Germany) in 0.1 M sodium cacodylate buffer (SCB ...
-
bioRxiv - Neuroscience 2023Quote: ... were placed in the middle of a 2% agar plate containing a container with 10 µl n-amylacetate (AM, diluted 1:50 in mineral oil; SAFC) or 3-Octanol (3-Oct, Sigma) on one side and a blank on the other side ...
-
bioRxiv - Plant Biology 2023Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H assay (20mM for pdistal ...
-
bioRxiv - Microbiology 2023Quote: ... organoids were treated four days after ex vivo Hsp60 deletion with the Ido1 agonist 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich) or the Ido1 antagonist dimethyltryptamine (1-D-MT ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and SK-OV-3 cells were treated with the dicarbonyl stress-inducing compound methylglyoxal (MG) (M0252, Sigma-Aldrich) for 48-72 h.
-
bioRxiv - Synthetic Biology 2024Quote: ... Lysate samples were MWCO filtered using 3 kDa and 10 kDa Amicon filters (Merck Millipore, catalog no.: UFC500308 (3 kDa), UFC501008 (10 kDa) ...
-
bioRxiv - Plant Biology 2024Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H screen/ assay ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice received daily intraperitoneal injections of L3,4-dihydroxyphenylalanine methyl (L-DOPA or levodopa, 3 days at 3 mg/kg and then 6 mg/kg, Sigma-Aldrich) and benserazide hydrochloride (12 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: 4-week-old TRE-Arhgef11/Krt14-rtTA mice (3 males and 3 females) were IP-injected with 25 mg/kg doxycycline (Sigma) 10 hours before sacrifice and tissue collection.
-
bioRxiv - Cell Biology 2024Quote: ... 3×flag-N-WASP or 3×flag-WIP2 C2C12 cells were immunostained with mouse anti-Flag (1:200; Sigma; F1804), rabbit anti-WAVE2 (1:200 ...
-
bioRxiv - Cell Biology 2024Quote: ... the supernatants described above were diluted 10-fold with 0.1% formic acid and separated on a Discovery HS-F5-3 column (150 × 2.1 mm, 3 μm particle size; Sigma- Aldrich) with mobile phases consisting of solvent A (0.1% formic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein solution was centrifuged at 16,000 g for 30 minutes with a 3 kD cut-off filter (Amicon Ultra Centrifugal Filter, 3 kDa MWCO, Merck Millipore) to remove previous buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng/μL NGF and 40 μM 5-UfDU (uridine and 5-fluorodeoxyuridine, Sigma). Cultures were maintained at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... was diluted in molecular biology-grade water and 5-fluorouracil (5-FU) (Sigma-Aldrich) diluted in dimethyl sulfoxide (SigmaAldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2.with a mixture of 5 μg/mL polybrene (Sigma TR-1003-G) and pseudovirus diluted to a titer that produces 1*108 total integrated intensity units/mL ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2021Quote: ... and 5 g glucose) with 5 μl Penicillin-Streptomycin Stabilized solution (Sigma-Aldrich, P4458) and 24 μl of Amphotericin B solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 5 mM Nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD, Sigma cat # N2630) solution were added to each well immediately prior to the beginning of measurements and mixed by pipetting to reach a concentration of 500 μM in the 50 μl final volume reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... fish were incubated for 5 min with 5 mg.ml-1 adrenaline (epinephrine, Sigma, E4642) in order to contract the pigment in melanocytes prior mounting in LMP for imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... the following 5-HTR antagonists were used: WAY100635 (W108, Sigma-Aldrich; for 5-HT1AR), GR55562 (cat# 1054 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5 mM nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD+, Sigma cat# N2630) was added to each well immediately before measurements ...
-
bioRxiv - Cell Biology 2024Quote: ... or pre-treated for 5 min and then incubated with 5 mM succinate (Sigma), or both in combination ...
-
bioRxiv - Microbiology 2023Quote: ... low = 5 X 105 parasites) or concanamycin A (CON A) (5 μg/ml, Sigma); supernatants were harvested at 72 h ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μM diphenyleneiodonium chloride (DPI) (Millipore-Sigma, D2926, resuspended to 5 mM in DMSO) in Hanks Balanced Salt Solution (HBSS ...
-
bioRxiv - Biochemistry 2023Quote: ... Disodium salts of nucleoside-5’-monophosphates (5’-NMPdss) were purchased from Sigma-Aldrich (Bangalore). All other reagents were purchased from Sigma-Aldrich and were of alalytical grade.
-
bioRxiv - Bioengineering 2023Quote: ... 5-Aminolevulinic acid hydrochloride >98% (5-ALA) (Sigma Aldrich, St. Louis, Missouri, United States) was used for cell dosing alongside standard GBM media ...