Labshake search
Citations for Millipore Sigma :
6551 - 6600 of 10000+ citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... stimulated with nicotine (Sigma Cat. # 6019-06-3, 50μg/ml), nicotine + angiotensin II (Tocris Cat ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 mM 3-mBz (m-toluic acid, Sigma-Aldrich) to induce msfGFP production ...
-
bioRxiv - Genomics 2024Quote: ... 3) 30 seconds in Harris’ modified Haematoxylin solution (Sigma HHS16), 4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis(succinimidyl succinate ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by coating with 3 mg/ml Concanavalin A (Sigma) for 1 hour at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... 50mg 3-(Acrylamido) phenylboronic acid (Sigma Aldrich Cat No. 771465), 1ml 10X RNase-free TAE ...
-
bioRxiv - Cell Biology 2024Quote: ... the substrate was treated with (3-Aminopropyl) triethoxysilane (Sigma-Aldrich), diluted at 5% in absolute ethanol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3% bovine serum albumin (w/v) (Sigma, A-7888) at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were blocked with 3% donkey serum (Millipore Sigma, D9663) in PBS for 2 hours at room temperature and incubated overnight at 4°C using the following concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μL of 3 mg/mL Collagenase (Sigma-Aldrich, C6885) was added to the supernatant and the mixture was incubated at 37°C for 45 minutes under constant shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking with a 3% goat serum (Sigma-Aldrich – S26) solution in PBS for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... using 3:1 polyethylenimine (average Mw, ∼25,000 Da; Sigma-Aldrich) to total DNA ratio (4 μg BRSK and 2 μg TAU DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 µM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich #I5879), and 1 µM dexamethasone (Gbiosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phase separation was achieved with 1-bromo-3-chloropropane (Sigma), and the resulting aqueous phase was precipitated in isopropanol ...
-
bioRxiv - Biophysics 2024Quote: ... 500 mM 3-(1-Pyridin)-1-Propansulfonat (NDSB-201; Sigma) for protein stabilisation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and blocked (3% BSA (Bovine Serum Albumin, Sigma-Aldrich #A7030) and 0.1% Tween (Sigma-ldrich)) ...
-
bioRxiv - Cancer Biology 2024Quote: 3% poly-2-hydroxyethyl methacrylate (poly-HEMA; P3932, Sigma-Aldrich) solution was prepared in 95% absolute ethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μM Nigericin (Sigma-Aldrich, N7143, CAS: 28643-80-3), 2.5 μM Saliphenylhalamide (Salip ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 purchased from Sigma Aldrich, MO ...
-
bioRxiv - Neuroscience 2024Quote: ... permeabilized for 30 min with 3% Triton-X (Millipore Sigma) in 1x PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... and phase-separated in 1-bromo-3-chloropropane (B9673, Sigma) [82,95] ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by endogenous peroxidase inactivation with 3% H2O2 (Sigma-Aldrich) and subsequently blocked in 5% BSA in TBS-T with TBS washes inbetween each step ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM DTT supplemented with 3 mM ATP (Sigma) and 3 mM MgCl2 ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Immunology 2024Quote: ... 0.3% Triton X-100 and 3% Bovine Serum Albumin (Sigma). Cells were stained with antibodies for 30m-1h at room temperature or up to overnight at 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and IBMX (3-Isobutyl-methylxanthine, 25µM, Sigma-Aldrich, Toluca Mexico) with ACSF was perfused for 25min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 mM MgCl2) containing 250 U/ml Benzonase (Sigma, E1014), 1X cOmplete EDTA-free protease inhibitor cocktail (Roche ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently washed 3 times with PBS 2% FBS (Sigma). pDCs were enriched from freshly isolated PBMCs using the human Plasmacytoid Dendritic Cell Isolation Kit II (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2024Quote: ... a 2% 3-(Trimethoxysilyl)propyl methacrylate (TMSPMA, Sigma-Aldrich 440159) (v/v ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lineage-labeling was induced at indicated time points using fresh or pre-heated (65°C for 10 min) 4-Hydroxytamoxifen (4-OHT) (Sigma H7904) stock solutions in DMSO at a final concentration of 10 μM in E3 embryo medium (Felker et al. ...
-
bioRxiv - Developmental Biology 2021Quote: Recombination of Col1a2xLPCherry-Tg was induced by keeping animals in separated tanks with water containing (Z)-4-hydroxytamoxifen (4-OHT, Sigma T5648) 2 µM overnight ...
-
bioRxiv - Biochemistry 2019Quote: ... Freshly purified CsgA was filtered using a 30 kDa cut-off column at 4°C (Amicon® Ultra-4, Sigma-Aldrich) to remove insoluble protein aggregates and seeds ...
-
bioRxiv - Genetics 2020Quote: ... cells were fixed at day 4 of differentiation with 4% paraformaldehyde for 20 minutes at 4°C followed by permeabilization with 0.1% triton™X-100 (Sigma Aldrich) for 30 minutes at room temperature and blocking in 1xPBS with 1% fetal bovine serum (Gibco) ...
-
bioRxiv - Plant Biology 2021Quote: ... roots of Arabidopsis thaliana Col-0 and sr45-1 mutant seedlings (or 9-week-old plants) were vacuum infiltrated with HCl (4%, v/v) and K-Ferrocyanide (II) (4%, w/v, Sigma-Aldrich) (1/1 ...
-
bioRxiv - Cancer Biology 2022Quote: Primary tumor samples and lungs were fixed in 4% paraformaldehyde (PFA) at 4°C for 24 h and decalcified in 14% EDTA (Sigma-Aldrich) for up to 56 d at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1×106 cells were fixed overnight in a solution containing 4% formaldehyde and 4% acrylamide in PBS and adhered to a poly-L-lysine (Sigma, P4707) coated coverslip ...
-
bioRxiv - Molecular Biology 2020Quote: ... the ERS alleviator 4-phenyl butyric acid (4-PBA, 5 mM) and the ATF6 inhibitor Ceapin-A7 (500 nM) were purchased from Sigma-Aldrich. Chondrocytes were cultured in DMEM supplemented with Tm or Tg for 6 h ...
-
bioRxiv - Immunology 2020Quote: ... extracellular Cn were removed by washing 2X with PBS and the macrophages were cultured for a further 24 h in fresh growth media containing either IFNγ to maintain the M1 polarization state or 100 ng/mL recombinant interleukin-4 (IL-4; Sigma-Aldrich, St ...
-
bioRxiv - Cancer Biology 2021Quote: ... were used to infect subconfluent MCF7 KRT19 KO cells in three sequential 4 h incubations in the presence of 4 μg/ml polybrene (Sigma-Aldrich). Transductants were selected in hygromycin (100 μg/ml) ...
-
bioRxiv - Neuroscience 2021Quote: ... With the fluorescent GCase substrates blue fluorogenic substrate 4-methylumbelliferyl-β-D-glucopyranoside (4-MU) (Sigma-Aldrich; as described in 11,12), PBMCs were washed 2x with PBS and lysed in 60μl of activity assay buffer (50mM Citric acid ...
-
bioRxiv - Neuroscience 2022Quote: ... where they were lightly anesthetized with isoflurane (to reduce stress from injection) and intraperitoneally injected with 4-hydroxytamoxifen (4-OHT; Sigma-Aldrich) at a dose of 50 mg/kg ...
-
bioRxiv - Immunology 2022Quote: Itaconate (ITA) and its derivatives 4-octyl itaconate (4-OI) and Dimethyl itaconate (DMI) were purchased from Sigma-Aldrich (Deisenhofen, Germany) (ITA ...
-
bioRxiv - Neuroscience 2019Quote: ... ubi:Switch double transgenic fish were immersed either for ten minutes in fish water containing 0.5 μM 4-hydroxytamoxifen (4-OHT - Sigma-Aldrich, T176) for clonal recombination of the reporter construct or 7 hours per day ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were extracted and post-fixed for at least 1 day in 4% PFA at 4°C and transferred to 30% sucrose (Millipore Sigma) for at least 1 day at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: EMT was induced in the HTER and HSER cell lines by chronic stimulation with 4 ng/ml 4-hydroxytamoxifen (4OHT; Sigma Aldrich) for 14 days9 ...
-
bioRxiv - Biophysics 2020Quote: ... pooled and concentrated to 2-4 mg/mL using Amicon Ultra-4 (100 kDa molecular weight cut off) concentrator tubes (EMD Millipore), flash frozen in liquid nitrogen and stored at −80°C.
-
bioRxiv - Neuroscience 2019Quote: ... with the following modifications: 4-day-old female adult brains were dissected in PBS and then fixed in 4% (wt/vol) paraformaldehyde (Sigma-Aldrich) in PBS on ice for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... TrkCCreERT2::Rosa26ChR2-YFP mice were treated with a single intrathecal (i.t.) injection of 45 ng of 4-hydroxytamoxifen (4-OH Tamoxifen, Sigma Aldrich, H7904). Experiments were performed at least one week after the treatment.
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.4) for 1 hour at room temperature and then incubated at 4°C overnight with primary antibodies (anti-multicillin, Sigma Aldrich, HPA058073 1:500 ...
-
bioRxiv - Plant Biology 2020Quote: Spin trapping assays with the spin probe 4-pyridyl-1-oxide-N-tert-butylnitrone (4-POBN; Sigma-Aldrich, St. Louis, USA) to detect the formation of hydroxyl radicals24 were carried out using cyanobacterial cells (OD730 = 0.65 ...