Labshake search
Citations for Millipore Sigma :
6451 - 6500 of 10000+ citations for Folate receptor alpha FOLR1 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Blastocysts were cultured on irradiated mouse embryo fibroblasts (PMEF-N, Millipore Sigma) in ESGRO-2i medium (Millipore Sigma SF016-100 ...
-
bioRxiv - Biochemistry 2019Quote: ... followed by incubation with mouse monoclonal anti-myc antibody (RRID: AB_309938, Millipore) at a 1:2,000 dilution in TBS and 3% (w/v ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Commercial available antibodies are mouse anti-Flag (1:1000, Sigma, M2, F3165), and mouse anti-α-tubulin (1:150 ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies were detected by Texas Red-conjugated goat-anti mouse (Sigma) or FITC-conjugated goat anti-rabbit (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... before adding secondary antibody (peroxidase-conjugated anti-mouse IgG [A9044, Sigma-Aldrich]) diluted 1:2000 in ELISA III buffer for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... p62-Alexa Fluor 488 mouse antibody for flow cytometry was from Millipore or R&D Systems ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse monoclonal anti-γH2AX antibody (IgG1) is from clone JBW301 (Millipore) and the mouse monoclonal anti-ß-Tubulin III (IgG2A ...
-
bioRxiv - Developmental Biology 2019Quote: ... followed by rabbit anti-mouse collagen type IV (Millipore, AB756P, 1:200) or rat anti-mouse CD31 (BD Biosciences ...
-
bioRxiv - Cell Biology 2019Quote: ... The primary antibodies used were mouse anti-Flag (1:1,000, Sigma-Aldrich), rabbit anti-Flag (1:1,000 ...
-
bioRxiv - Immunology 2019Quote: ... Sections were stained with primary Abs (rabbit anti-mouse laminin (Sigma Aldrich), Alexa fluor 594 Goat anti-mouse IgM (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... then incubated with primary antibodies (mouse anti-PAR, 1:400 Merck Millipore Cat#AM80 RRID ...
-
bioRxiv - Microbiology 2019Quote: ... The following antibodies were used: mouse anti-γH2AX (EMD Millipore, Billerica, MA), rabbit anti-53BP1 (Novus Biologicals ...
-
bioRxiv - Cancer Biology 2019Quote: ... Resulting immunocomplexes were detected by HRP-conjugated anti-mouse IgG (A4416, Sigma) or anti-rabbit IgG (A6154 ...
-
bioRxiv - Cell Biology 2019Quote: ... monoclonal mouse anti-α-tubulin (1:500; Sigma-Aldrich; T9026; clone DM1A), rabbit polyclonal anti-α-tubulin (1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... and tagged proteins were detected with mouse anti-GFP (Sigma, 1:5,000), rat anti-HA (Sigma 3F10 clone ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies were conjugated with anti-mouse IgG-peroxidase (1:10000; Sigma), anti-goat IgG-horseradish peroxidase (HRP) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Genotyping was performed using the KAPA HotStart Mouse Genotyping Kit (Sigma, KK7352) using GFP primers ...
-
bioRxiv - Cell Biology 2019Quote: ... Horseradish peroxidase–conjugated secondary antibody (anti-mouse) was obtained from Sigma-Aldrich. For Western blotting ...
-
bioRxiv - Neuroscience 2019Quote: ... Mouse anti-β-actin primary antibody (1:5000) was from Sigma-Aldrich.
-
bioRxiv - Microbiology 2019Quote: ... Peroxidase-conjugated anti-Mouse or anti-Rabbit IgGs (Sigma, dilution 1:5000) were used as secondary antibodies ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse monoclonal anti-α-tubulin-FITC antibody was obtained from Sigma-Aldrich Co (Cat# F2168) ...
-
bioRxiv - Neuroscience 2019Quote: ... unphosphorylated tau (Tau-1 mouse monoclonal, 1:200 dilution, Millipore, Temecula, California), total tau (Tau46 mouse monoclonal ...
-
bioRxiv - Microbiology 2019Quote: The anti-FLAG M2 mouse monoclonal antibody was purchased from Sigma-Aldrich. 60 μg of protein lysate was separated by SDS-PAGE (BioRad Miniprotean TGX 4-20% ...
-
bioRxiv - Molecular Biology 2019Quote: ... Slides were incubated with primary 1:1000 mouse α-Tub1a (Sigma -T6793) antibody and detected with 1:200 anti-rabbit CY3 (Jackson Immunoreserach ...
-
bioRxiv - Genetics 2019Quote: Primary antibodies used were mouse monoclonal anti-histones (Sigma #MABE71; 1:1000), rabbit polyclonal anti-DHD (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-mouse tyrosine hydroxylase (TH; 1:1000; Millipore Sigma, Cat# MAB318, RRID:AB_2313764), or anti-rabbit NeuN (1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... (mouse) from DSHB and 1:1000 anti Actin (Rabbit) A5060 from Sigma and 1:1000 for anti-dPIP4K antibody (Rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... We also used mouse anti-puromycin clone 12D10 (1:1000, EMD Millipore), rat anti-LAMP1 (1:200 ...
-
bioRxiv - Genetics 2020Quote: ... anti-mouse secondary antibody tagged with alkaline phosphatase (Sigma, catalogue no: A3562), CDP star (sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1/800 mouse anti-beta-3-tubulin (T5758, Sigma, St. Louis, MO), 1/100 anti-mouse-TRPV1 (sc-398417 ...
-
bioRxiv - Neuroscience 2020Quote: ... Antibodies used were mouse anti-NeuN (1:250, Millipore, Burlington, MA, #MAB377), chicken anti-NF200 (1:250 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse monoclonal anti-α-tubulin (Sigma-Aldrich, dilution-1:1000, catalogue #T5168), rabbit polyclonal anti-RBM14 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... Fixed cells were incubated with primary mouse monoclonal anti-FLAG M2 (Sigma) and rabbit polyclonal anti-S ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-<ι>α-Tubulin (Millipore T9026, clone DM1A; 1:10,000). Secondary antibodies were incubated in 5% BLOT-QuickBlocker (G-Biosciences 786-011 ...
-
bioRxiv - Neuroscience 2020Quote: ... a mouse anti-parvalbumin polyclonal antibody (1:1000, catalog: P3088, Sigma Aldrich) and a rabbit anti-vasoactive intestinal peptide (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-mouse and anti-rabbit HRP-conjugated antibodies were from Sigma-Aldrich. Alexa488-conjugated Phalloidin was from Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse anti-Pan-Neuronal Marker (PNM) 1:200 (MAB2300, EMD Millipore). The following secondary antibodies were used ...
-
bioRxiv - Neuroscience 2020Quote: ... cytokeratin-18 - CK18 (1:50; mouse polyclonal; MAB3234 – RGE53, Sigma-Aldrich, France), ionized calcium-binding adapter molecule 1 - Iba1 (1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... βIII-Tubulin immunostaining (mouse monoclonal, 1:500, Sigma-Aldrich, cat. number ab78078) was performed using the same procedure except for HCL and trypsin treatments ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-FLAG (1:1000, M2 clone, Sigma, St. Louis, MO, #F3165)] ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-FLAG (1:1000, M2 clone, Sigma, St. Louis, MO, #F3165), rabbit anti-SNAP (1:1000 ...
-
bioRxiv - Bioengineering 2020Quote: Lactate toxicity was evaluated on primary mouse cardiomyocytes using calcein-AM (Sigma) and Propidium iodide (Fluka ...
-
bioRxiv - Bioengineering 2020Quote: Lactate toxicity was evaluated on primary mouse cardiomyocytes using calcein-AM (Sigma) and Propidium iodide (Fluka ...
-
bioRxiv - Plant Biology 2021Quote: ... or mouse monoclonal ANTI-FLAG® antibody conjugated to HRP (M2, Sigma) in a 1:4000 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... and an Alexa Fluor 488-conjugated mouse anti-NeuN antibody (Merck Millipore, MAB377X ...
-
bioRxiv - Neuroscience 2021Quote: ... primary antibodies used were Mouse anti-GFP (1:100, Sigma, catalog #G6539) and rabbit anti-DsRed (1:2,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... The mouse cytokine/chemokine panel (MCYTOMAG-70K-04; Millipore, Billerica, MA, USA) and bead-based Luminex system were used to detect the concentrations of IFN-γ ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: parvalbumin (mouse, 1:500, Millipore MAB1572), COX-IV (rabbit ...
-
bioRxiv - Biophysics 2021Quote: ... or with a primary mouse monoclonal antibody against talin (Sigma, T-3287), FAK (BD Transduction ...