Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for Mouse OLFR139 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: Five MISSION shRNAs specific for each splicing regulator were purchased from Sigma in pLKO lentiviral vectors and their effects were compared with those of SHC002 mammalian non-targeting MISSION shRNA (Sigma). The effect of each shRNA was tested on MEFs and E14 embryonic stem cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... with the latter of containing a short hairpin RNA (shRNA) targeting either RhoA or a non-target sequence (Sigma), using the Polyfect reagent (Qiagen) ...
-
bioRxiv - Immunology 2019Quote: ... scrambled control shRNA containing lentiviral particles or 4MOI of targeting shRNA containing viral particles in medium supplemented with 8µg/ml DEAE-dextran (Sigma). Medium was exchanged after 24 hours and puromycin (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... and anti-CD28 (2ug/ml) for 48 hours before introduction of 1.6ug empty vector or Cad-targeted shRNA (TRCN0000032550, Sigma) using Lipofectamine 3000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Cancer Biology 2022Quote: shRNA targeting DCLK1 (NM_004734.2-2100s21c1; sh3 and NM_004734.3-2287s21c1; sh4) and a scrambled shRNA was obtained from Sigma Aldrich (Milwaukee, USA). Lentiviral particles were generated using the pLVX Advanced plasmid system (CloneTech Laboratories Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... The S2-013 and S2-LM7AA lines were transduced with lentivirus encoding either shRNA against ST6GAL1 (Sigma, cat#TRCN00000035432) or a control shRNA (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cGAS knockdown for RNA interference was achieved using Mission shRNA-encoding lentivirus directed to human cGAS mRNA (Sigma; GenBank/EMBL/DDBJ accession no ...
-
bioRxiv - Molecular Biology 2020Quote: ... was obtained by the transfection of shRNA directed against the 3’ UTR region of Aurora-A (clone NM_003600.x-985s1c1, Sigma) followed by clonal dilution and selection of Aurora-A depleted cells with 2 μg/ml of puromycin.
-
bioRxiv - Microbiology 2021Quote: An shRNA lentiviral vector targeting the CDS region of PROX1 mRNA (Clone ID: NM_002763.3-531s21c1) was purchased from Sigma-Aldrich. Lentiviral particles were prepared by transfecting HEK293T cells with pLKO.1-shPROX1 (or pLKO.1-shControl) ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1-nontarget small hairpin RNA (shRNA) control vector (SHC002) and pLKO.1-shSOCS6 (TRCN0000284351) were purchased (Sigma Aldrich).
-
bioRxiv - Cancer Biology 2021Quote: ... or a non-targeting control shRNA (TRCN0000231489) with no targets in the human genome were obtained from Sigma-Aldrich. The SLFN11 expression vector was obtained from VectorBuilder along with an empty vector control with the same lentiviral backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... were incubated with shRNA-encoding lentivirus supernatants in the presence of 6 μg/ml polybrene (hexadimethrine bromide; Sigma-Aldrich). Twenty-four hours after infection ...
-
bioRxiv - Physiology 2023Quote: Rab7-/- MEFs expressing control or Rab27 shRNA lentiviruses were treated with DMSO or 50 nM Bafilomycin A1(Millipore-sigma) or Oligomycin+ Antimycin A (10μM+10μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... For shRNA knockdown with lentiviral infection, Mission shRNAPP4C (pLKO.1-puro, Clon ID #TRCN0000080835) were obtained from Sigma-Aldrich, Inc ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors containing validated shRNA sequences targeting expression of human PRKCD (accession NM_006254) or a non-target control were obtained from Sigma (catalog numbers TRCN0000010193 ...
-
bioRxiv - Molecular Biology 2023Quote: Lentiviral shRNA vectors targeting PSIP1 (PSIP1 ShRNA1 TRCN0000298567, PSIP1 shRNA2 TRCN0000286345) and non-targeting control were procured from Sigma Life Sciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of the dCasRX-YTHDC1 fusion protein was confirmed by transfection of the plasmid followed by Western Blot with anti-FLAG M2 mouse monoclonal antibody (F1804, Sigma-Aldrich) and anti-YTHDC1 (14392-1-AP ...
-
bioRxiv - Cell Biology 2019Quote: ... Mission plasmids (Sigma) encoding for two different shRNA against Mtf1 and a scramble (scr ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pET28a (+) (Novagen) and lytE (from the 76th bp ...
-
bioRxiv - Molecular Biology 2023Quote: Mission plasmids (Sigma) encoding for two different shRNA against specific subunits of the three subfamilies of mSWI/SNF complexes BAF (Baf250A ...
-
bioRxiv - Microbiology 2024Quote: Plasmids pET15b (Novagen), pET20b and pETDuet-1 have been described ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were harvested using the GenElute HP plasmid maxiprep kit (Sigma), using 200 ml of culture per plasmid purification column ...
-
bioRxiv - Microbiology 2020Quote: ... plasmid DNA was isolated (GenElute Plasmid Miniprep Kit™, Sigma Aldrich) and further amplified by vector-PCR ...
-
bioRxiv - Synthetic Biology 2019Quote: ... the plasmids were extracted using GenElute Plasmids Miniprep Kit (Sigma-Aldrich) and verified by sequencing ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the plasmids were extracted using GenElute Plasmids Miniprep Kit (Sigma-Aldrich). Each operon constituting the circuits was constructed monocistronically and its sequence was verified before combined into circuits ...
-
bioRxiv - Microbiology 2022Quote: ... plasmids were isolated using a GenElute Plasmid Miniprep Kit (Sigma-Aldrich) and sequenced using standard primers EGFP-C-for (GTCCTGCTGGAGTTCGTG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid minipreps were prepared using GeneElute Plasmid MiniPrep Kit (Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... RD cells were transduced with shRNA control lentivirus particles or shMCU lentivirus particles with polybrene (8μg/ml) (Sigma-Aldrich Inc.). Transduced cells were selected with 1μg/ml puromycin (Sigma-Aldrich Inc. ...
-
bioRxiv - Developmental Biology 2021Quote: ... Human fibroblasts were doubly transduced with either shRNA or CRISPR vectors in consecutive days in the presence of 8 µg/ml protamine sulfate (Sigma). Transduced cells were selected by puromycin at 1 μg/ml.
-
bioRxiv - Molecular Biology 2021Quote: Stable RNAi-mediated knockdown of TRMT2A was achieved by infection of HEK293T cells with commercially available Lentiviral particles (MISSION® shRNA Lentviral Transduction Particles NM_182984.2-1574s1c1; Sigma-Aldrich). Cells with stable integration of the shRNA construct were determined by a selection of puromycin-resistant colonies (0.5 μg/ml puromycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... The same procedure was used to generate a control cell line (short shK) expressing a scrambled shRNA (SHC002V; Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2021Quote: For stable knock down of PYCR1, shPYCR1 (shPCYR1 #1: CCGGTGAGAAGAA GCTGTCAGCGTTCTCGAGAACGCTGACAGCTTCTTCTCATTTTTG, shPYCR1 #2: CCGGCACAGTTTCTGC TCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG) and shCTL (Sigma, Mission shRNA) lentivirus was generated in HEK293 cells ...
-
bioRxiv - Cancer Biology 2021Quote: MFSD1kd tumor cells were generated by MISSION lentiviral transduction particles expressing short hairpin RNA (shRNA) from pLKO.1 vector targeting the coding sequence of MFSD1 (Sigma, TRC clone ID TRCN0000338002 and TRCN0000337937 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable cell lines were established using gene specific mission shRNAs (Cat# TRCN0000000595, TRCN0000000592, TRCN0000230910) or non-targeting control (Sigma-Aldrich). Cells were plated at 5×105 in a 6-well dish in growth medium containing 8μg/mL polybrene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The same method was used for virus to be used for GSCs (DMEM was changed to NBM).The shRNA construct number TRCN0000152163 from Sigma human TRC shRNA library was used for knockdown studies of human FMOD ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNA and packaging vectors (pMD2.G and psPAX2) were transiently co-transfected into 293T cells by polyethylenimine (Sigma, P3143), and the resulted lentivirus particles were harvested and precipitated by PEG8000 ...
-
bioRxiv - Immunology 2022Quote: Stable knockdown of host proteins in THP1 cells was carried out by transduction with lentivectors expressing individual shRNAs (pLKO.1, 400 ng p24Gag (as measured by ELISA) per 1 × 106 cells) in the presence of polybrene (Millipore). Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... Two pLKO.1 lentiviral vectors encoding for specific shRNA for two human MAPK7 mRNA sequences were used (TRCN0000010262/pLKO.1 and TRCN0000010275/pLKO.1, Sigma). Lentiviral particles were generated in HEK-293 cells by co-transfecting the virion vectors (psPAX2 and pMD2G ...
-
bioRxiv - Molecular Biology 2019Quote: ... and expression of shRNAs were monitored under microscope by RFP expression after 96 hours treatment with 2mg/mL Doxycycline (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... were infected with lentiviral pLKO.1-puro vectors expressing specific shRNA sequences for 24 h in the presence of polybrene (8μg/ml; Sigma-Aldrich). After further 24 hrs ...
-
bioRxiv - Genetics 2020Quote: Previously validated shRNA-encoding oligos targeting murine Ubr5 and or a scrambled sequence were cloned into pLKO.1-puro (Sigma). shUBR5 and shScrambled-pLKO.1-puro were co-transfected with pCMV-VSV-G and pCMV-dR8.2 dvpr plasmids into HEK 293T cells using TransIT293 reagent (Mirus Bio LLC ...
-
bioRxiv - Cell Biology 2022Quote: ... two shRNA targeting exon 5 and exon 6 were synthesized along with a control shRNA targeting the luciferase gene as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRor2-1 and shRor2-2 hairpin sequences correspond with shRor2-94 and -98 clones from the MISSION pLKO Lentiviral shRNA libraries (Sigma). Wnt pathway reporters (plasmid 7TGC #24304 ...
-
bioRxiv - Cell Biology 2021Quote: WT and SIRT1 KO mESCs with stable Smpdl3b knockdown were generated by infecting WT and SIRT1 KO mESCs with lentivirus containing vector pLKO.1 or constructs expressing shRNAs against Smpdl3b (B11, B12, and C1) (Sigma). WT and SIRT1 KO mESCs with stable overexpression of SMPDL3B were generated with lentivirus carrying vector Plenti-III-ef1α (Abm ...
-
bioRxiv - Cell Biology 2021Quote: ... or control non-target shRNAs were induced to differentiate for 6 days and RNA was extracted with Tri-Reagent (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentiviral vectors encoding for shRNAs sequences targeting CDA (CCGGCATGAGAGAGTTTGGCACCAACTCGAGTTGGTGCCAAACTCTCTCATGTTTTTG) were cloned into pLKO.1 puromycin vector and obtained from Sigma. Vectors encoding for random shRNA (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... DM cells were infected by shRNA lentivirus twice via spinoculation in the presence of 5 μg/mL polybrene (Sigma-Aldrich). 72 hours post transduction ...
-
bioRxiv - Immunology 2023Quote: The shRNA oligos were designed from the Broad Institute Genetic Perturbation platform and the shRNA clones in pLKO.1 were purchased from Sigma. The three oligo sequences for pLKO.1-shSAMD9L are ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP-PMCA4bLA and PMCA4-specific shRNA expressing MCF-7 lines were mixed with cold Matrigel (Corning Matrigel, DLW356231, Sigma-Aldrich) and 15 µl of cell-Matrigel mixtures were added to removable 8-well chambers (80841 ...