Labshake search
Citations for Millipore Sigma :
601 - 650 of 4285 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... or human liver microsomes (HLMs) (male human pooled, Sigma-Aldrich), respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human haemoglobin (Sigma) was used for creation of standard curve.
-
bioRxiv - Microbiology 2021Quote: ... human insulin (Sigma), 10’000 units/ml of penicillin and 10’000 µg/ml streptomycin (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... human HDL (Millipore), human LDLs (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... human LDLs (Millipore) or an in vitro reconstituted NS1-HDL mix were analyzed by size exclusion chromatography on a Superdex 200 10/300 column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human hemoglobin (Sigma) was dissolved in PBS to 10 mg/mL or 1 mg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Human DPP4 (Sigma) was used as a control in PBS at 50 ng/μL (0.585 μM) ...
-
bioRxiv - Immunology 2020Quote: ... PD1kd 4T1 and AT3 cells were generated by lentiviral transduction with PD1 specific shRNAs from Sigma (TRCN0000097670-74). Control cells were transduced an empty vector (pLKO) ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentiviral particles for shRNA knockdown of NTRK2 were produced following transfection of the lentiviral packaging vectors (pΔ8.9 and VSV-g) and either the PIK3CA shRNA vector (TRCN0000197207; Sigma) or the control shRNA vector (SHCOO2 ...
-
bioRxiv - Molecular Biology 2019Quote: CYLD knockdown was achieved using a stably expressed lentiviral pLKO.1 puro mouse CYLD shRNA construct (Sigma, MC5) and nontarget shRNA (Sigma ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: shRNA Endo180 knock-down clones from 3T3 and CAFs were generated using lentiviral particles (Sigma, Supplementary Table 3). For siRNA knockdown ...
-
bioRxiv - Neuroscience 2021Quote: Ten days post induction of shRNA against TDP-43 with 1 μg/ml doxycyline hyclate (Sigma D9891-1G), SH-SY5Y cells were treated either with 100 μM cycloheximide (CHX ...
-
bioRxiv - Neuroscience 2021Quote: ... For induction of shRNA against TDP-43 cells were treated with 5 μg/mL Doxycyline Hyclate (Sigma D9891). After 3 days media was replaced with Neurobasal (Thermo ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shVCP (TRC0000004249) and shHER3 (TRCN0000218392) pLKO.1 constructs were from the Mission shRNA collection from Sigma-Aldrich. Lentivirus particles expressing shRNA against the gene of interest were generated by co-transfection with the VSV-G packaging and CDNL envelope plasmids (courtesy of Biplab Dasgupta ...
-
bioRxiv - Cancer Biology 2022Quote: For lentiviral production, shRNA clones targeting CAD (TRCN0000045910, TRCN0000045908) and DHODH (TRCN0000025868, TRCN0000025839) were purchased from Sigma-Aldrich, doxycycline inducible shRNA targeting DPYD (V2THS_84048 ...
-
bioRxiv - Cancer Biology 2020Quote: Single stranded cDNA sequences of mouse Id1 and Id3 shRNAs were purchased from Sigma-Aldrich (Lismore, NSW, Australia). The Id1 shRNA sequence which targets 5’-GGGACCTGCAGCTGGAGCTGAA-3’ has been validated earlier (Gao et al. ...
-
bioRxiv - Immunology 2020Quote: ... Huh7 cells were transduced with the indicated shRNA expressing lentivirus then selected with 2 μg/ml puromycin (Sigma). After selection ...
-
bioRxiv - Cancer Biology 2019Quote: ... and lentiviral vectors: non-targeting control (PLK0.1) or p75NTR-targeting MISSION shRNA constructs (Sigma-Aldrich, TRCN0000058153 and TRCN0000058153). The medium was changed 8 hours post-transfection ...
-
bioRxiv - Molecular Biology 2019Quote: HCT116 cells were transfected with pLKO.1 vector expressing either an eIF6 targeted shRNA (CCGGGTGCATCCCAAGACTTCAATTCTCGAGAATTGAAGTCTTGGGATGCACTTTTT G, Sigma - TRC327700) or a control non-targeting shRNA (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: Four Lenti-pLKO.1-puro shRNA vectors that specifically targeted COL7A1 mRNA sequences were chemically synthesized (Sigma Aldrich) and included in viral particles:
-
bioRxiv - Biochemistry 2023Quote: ... HEK 293t cells were infected with commercially available Lentiviral particles for hTRMT2A KD and scrambled control cell line (MISSION® shRNA Lentviral Transduction Particles: scrambled control WT = SHC002V, KD1 = NM_182984.2-856s1c1, KD2 = NM_182984.2-1574s1c1; Sigma-Aldrich). Cells with stable integration of shRNA were selected as puromycin-resistant colonies ...
-
bioRxiv - Cancer Biology 2023Quote: METTL3 (sh1 and sh2) and Control shRNA in pLKO.1-TRC cloning vector were purchased from Sigma-Aldrich to generate stable METTL3-KD cells ...
-
bioRxiv - Neuroscience 2024Quote: For induction of shRNA against TDP-43 cells were treated with the following amounts of doxycycline hyclate (Sigma), and collected after 10 days:
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The plasmid that contains the kinase domain of human HASPIN was transformed into Escherichia coli strain Rosetta™ 2(DE3) pLysS (Novagen, Madison, WI, USA). The transformed cells were grown at 37□ until OD600 reached 0.8 ...
-
bioRxiv - Bioengineering 2019Quote: ... 100 µg/ml human recombinant Delta-1 or human IgG (Sigma) was added ...
-
bioRxiv - Immunology 2023Quote: ... Anti-human IgG HRP antibody (Anti-Human IgG-Peroxidase from Sigma) was diluted 1:30,000 in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid isolation was performed with GenElute plasmid miniprep kit (Sigma). All other standard DNA manipulation techniques such as analysis ...
-
bioRxiv - Molecular Biology 2020Quote: Five MISSION shRNAs specific for each splicing regulator were purchased from Sigma in pLKO lentiviral vectors and their effects were compared with those of SHC002 mammalian non-targeting MISSION shRNA (Sigma). The effect of each shRNA was tested on MEFs and E14 embryonic stem cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... with the latter of containing a short hairpin RNA (shRNA) targeting either RhoA or a non-target sequence (Sigma), using the Polyfect reagent (Qiagen) ...
-
bioRxiv - Immunology 2019Quote: ... scrambled control shRNA containing lentiviral particles or 4MOI of targeting shRNA containing viral particles in medium supplemented with 8µg/ml DEAE-dextran (Sigma). Medium was exchanged after 24 hours and puromycin (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... and anti-CD28 (2ug/ml) for 48 hours before introduction of 1.6ug empty vector or Cad-targeted shRNA (TRCN0000032550, Sigma) using Lipofectamine 3000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Cancer Biology 2022Quote: shRNA targeting DCLK1 (NM_004734.2-2100s21c1; sh3 and NM_004734.3-2287s21c1; sh4) and a scrambled shRNA was obtained from Sigma Aldrich (Milwaukee, USA). Lentiviral particles were generated using the pLVX Advanced plasmid system (CloneTech Laboratories Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... The S2-013 and S2-LM7AA lines were transduced with lentivirus encoding either shRNA against ST6GAL1 (Sigma, cat#TRCN00000035432) or a control shRNA (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... was obtained by the transfection of shRNA directed against the 3’ UTR region of Aurora-A (clone NM_003600.x-985s1c1, Sigma) followed by clonal dilution and selection of Aurora-A depleted cells with 2 μg/ml of puromycin.
-
bioRxiv - Microbiology 2021Quote: An shRNA lentiviral vector targeting the CDS region of PROX1 mRNA (Clone ID: NM_002763.3-531s21c1) was purchased from Sigma-Aldrich. Lentiviral particles were prepared by transfecting HEK293T cells with pLKO.1-shPROX1 (or pLKO.1-shControl) ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1-nontarget small hairpin RNA (shRNA) control vector (SHC002) and pLKO.1-shSOCS6 (TRCN0000284351) were purchased (Sigma Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... were incubated with shRNA-encoding lentivirus supernatants in the presence of 6 μg/ml polybrene (hexadimethrine bromide; Sigma-Aldrich). Twenty-four hours after infection ...
-
bioRxiv - Physiology 2023Quote: Rab7-/- MEFs expressing control or Rab27 shRNA lentiviruses were treated with DMSO or 50 nM Bafilomycin A1(Millipore-sigma) or Oligomycin+ Antimycin A (10μM+10μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... For shRNA knockdown with lentiviral infection, Mission shRNAPP4C (pLKO.1-puro, Clon ID #TRCN0000080835) were obtained from Sigma-Aldrich, Inc ...
-
bioRxiv - Molecular Biology 2023Quote: Lentiviral shRNA vectors targeting PSIP1 (PSIP1 ShRNA1 TRCN0000298567, PSIP1 shRNA2 TRCN0000286345) and non-targeting control were procured from Sigma Life Sciences ...
-
bioRxiv - Cell Biology 2019Quote: ... Mission plasmids (Sigma) encoding for two different shRNA against Mtf1 and a scramble (scr ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pET28a (+) (Novagen) and lytE (from the 76th bp ...
-
bioRxiv - Molecular Biology 2023Quote: Mission plasmids (Sigma) encoding for two different shRNA against specific subunits of the three subfamilies of mSWI/SNF complexes BAF (Baf250A ...
-
bioRxiv - Microbiology 2024Quote: Plasmids pET15b (Novagen), pET20b and pETDuet-1 have been described ...
-
bioRxiv - Bioengineering 2022Quote: ... human iPSC-derived Brain Microvascular Endothelial-like cells were seeded in the vascular channel at a density of 14 to 16×106 cells/mL using human serum-free endothelial cell medium supplemented with 5% human serum from platelet-poor human plasma (Sigma) and allowed to attach to the membrane overnight ...
-
bioRxiv - Immunology 2020Quote: ... 100 µL of biotinylated secondary antibody diluted in PBS-BN (anti-human IgG, B1140, 1/1250; anti-human IgM, B1265, 1/1000; or anti-human IgA, SAB3701227, 1/500; Sigma) were added to all wells and incubated for 45 min at 600 rpm at RT and protected from light ...
-
bioRxiv - Immunology 2022Quote: Cells were blocked in human blocking buffer (5% human serum (Sigma-Aldrich), 1% rat serum (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were blocked in human blocking buffer (5% human serum (Sigma-Aldrich), 1% rat serum (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... human Akt1 (Sigma-Aldrich) or 0.3 μg active ...