Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... reversely transfected (human siTDP 5’-GCAAAGCCAAGAUGAGCCU-3’, Sigma-Aldrich or siLUC) and harvested 48 h later ...
-
bioRxiv - Microbiology 2022Quote: ... Pectinase activity by the 3’,5’-dinitrosalicylic acid (DNS) (Sigma-Aldrich) method (Miller ...
-
bioRxiv - Neuroscience 2019Quote: ... as control siRNA for Luciferase was used (5′-uaaggcuaugaagagauac-3′; Sigma). Immediately before transfection 2–4 × 105 cells were seeded in 6-well plates in 1.4 ml of medium containing 10% fetal serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... (5’-CACGGGACAGCCTGAGCGGAACGGTGCTAATCGTGCGGT-3’) strand of e5 probe were synthesized (Sigma-Aldrich) and sense strand was end labelled with [γ32P] ATP using T4 polynucleotide kinase according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... 40 nM of siTDP (mouse siTDP 5’-CGAUGAACCCAUUGAAAUA-3’, Sigma-Aldrich) or non-targeting siLUC (5’-UAAGGCUAUGAAGAGAUAC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Ref. 10760994001). The control DMRT5 transcript was prepared as previously described [50].
-
bioRxiv - Microbiology 2022Quote: ... 3-Methyl-1-phenyl-2- pyrazolin-5-one (Edaravone; Millipore 443300) was resuspended in ethanol at 500mM and heated at 65°C for solubilization ...
-
bioRxiv - Genomics 2022Quote: ... PNP-GMP (guanosine 5′-[β,γ-imido]triphosphate, 3 mM, Sigma) was included in the lysis buffer of TIS(Ret ...
-
bioRxiv - Neuroscience 2023Quote: ... CHIR99021 (3 μM) and LY411575 (5 μM, Sigma-Aldrich, no. SML0506)].
-
bioRxiv - Microbiology 2023Quote: ... 2’,3’,5’-Triacetyl-6-azauridine (azaribine; Sigma-Aldrich, Cat. # T340057), and brequinar sodium salt hydrate (brequinar ...
-
bioRxiv - Genetics 2023Quote: ... and 1µM adenosine 3’,5’-cyclic monophosphate (cAMP)(Millipore Sigma, #A9501). To aid in cell atachment ...
-
bioRxiv - Immunology 2023Quote: ... We implanted 5×105 EO771 (ATCC) or AT-3 (EMD Millipore) mouse mammary tumor cell lines and 1×105 mouse mammary fibroblasts orthotopically into 4th inguinal mammary fat pads of 6-8-week-old female C57BL/6J female mice (The Jackson Laboratory)(46) ...
-
bioRxiv - Cell Biology 2023Quote: ... cloned 5’-NdeI to 3’-NotI into pET21a(+) (Novagen, Madison, WI) (pET21a-APOL7C::FLAG::1XHis) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 million cells were fixed with ∼1% formaldehyde (Sigma-Aldrich) for 10 min and lysed ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate sodium salt (Sigma), and 0.1 mM IBMX (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Physiology 2022Quote: ... or ELISA (ghrelin; Millipore).
-
bioRxiv - Microbiology 2021Quote: ... Insulin was measured using the rat/mouse insulin ELISA kit from Millipore (EZRMI-13K), according to the manufacturer’s instructions (Wang et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP was also measured in the supernatant with a sandwich ELISA kits (Sigma NS830) using a 200x dilution ...
-
bioRxiv - Physiology 2019Quote: ... P10 and 10 weeks of age using a commercially available leptin ELISA kit (Millipore). Serum free fatty acid levels were assayed in chow-fed or HFHS-fed mothers at gestational day 16 and in the offspring of chow- or HFHS-fed dams at P10 and 10 weeks of age using a commercially available FFA kit (Abcam).
-
bioRxiv - Developmental Biology 2022Quote: GH was measured using a mouse/rat growth hormone ELISA kit (Millipore – EZRMGH-45K), based on quantitative sandwich enzyme immunoassay technique ...
-
bioRxiv - Microbiology 2023Quote: ... and IL-18 (BMS672TEN) in supernatants were measured using the ELISA Kit (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Neuropeptide Y levels were measured using commercially available ELISA kits (EMD Millipore, EZHNPY-25K).
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and Gnas E1+/− mice were administered alizarin complexone (AC) by intraperitoneal injection (dose 30mg/kg (Sigma A-3882)) 7 days prior to sacrifice by CO2 asphyxiation according to IACUC regulations ...
-
bioRxiv - Cell Biology 2020Quote: ... Blood was diluted in an equal volume of modified Tyrode’s buffer supplemented with prostaglandin E1 (PGE1) and apyrase (both from Sigma) and centrifuged at 150xg for 10 mins at room temperature (RT) ...
-
bioRxiv - Microbiology 2021Quote: ... were plated on synthetic complete (SC) plates containing 1□mg/ml 5-FOA (5-fluorotic acid; Sigma) and on non-selective SC plates/ ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was stained with 5% phosphomolybdic acid reagent (PMA) (Sigma) and heated briefly using an industrial blow-dryer to visualize the total amounts of lipids loaded in each lane.
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μl was loaded onto a Silica TLC plate (Sigma) and run with a 6.5:2.5:1 (chloroform:methanol:acetic acid ...
-
bioRxiv - Microbiology 2020Quote: ... plates were blocked with 5% bovine serum albumin (BSA) (Sigma-Aldrich) in PBS (BSA-PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... were subjected to 5% or 13% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membranes (PVDF, Millipore, Bedford, MA, USA). The following primary antibodies were used in this study ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... The plates were washed 3 times with 0.05% Tween-20 (P2287, Sigma-Aldrich) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... SC –leu-trp plates and SC –leu-trp-his + 10mM 3-aminotriazole (Sigma) plates ...
-
bioRxiv - Physiology 2022Quote: Auxin plates were prepared by adding auxin indole-3-acetic acid (Sigma-Aldrich) from a 400 mM stock solution in ethanol into NGM at the final concentration of 1 mM (Zhang et al ...
-
bioRxiv - Genomics 2023Quote: hiPSC-derived NPCs were maintained at high density on Matrigel (Corning)-coated plates and were split 1:3 once a week with Accutase (Millipore) into NPC media containing DMEM/F-12 Glutamax ...
-
bioRxiv - Microbiology 2020Quote: ... OMVs were treated with polymyxin B sulfate (Sigma-Aldrich) (10 μM ...
-
bioRxiv - Biophysics 2021Quote: ... sodium dodecyl sulfate (SDS, Sigma-Aldrich, St. Louis, MO), n-dodecyl β-D-maltoside (DDM ...
-
bioRxiv - Immunology 2022Quote: ... EGCG (heparan sulfate inhibitor, 100μM; Sigma-Aldrich E4143-50MG), or pixatimod/PG545 (heparan sulfate mimetic ...
-
bioRxiv - Biochemistry 2020Quote: ... fresh working stocks of dimethyl sulfate (DMS, Sigma-Aldrich) and 1-methyl-7-nitroisatoic anhydride (1M7 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Colistin sulfate (Sigma-Aldrich Chemical Company, Milwaukee, WI, USA) and creatinine-d3 (Cayman Chemicals ...
-
bioRxiv - Biochemistry 2020Quote: ... 10% w/v dextran sulfate (Sigma-Aldrich D8906-100G), 2 mM ribonucleoside vanadyl complex (NEB S1402S) ...
-
bioRxiv - Bioengineering 2020Quote: ... chondroitin-6-sulfate (0.84 weight per volume, Sigma Aldrich), and calcium salts (calcium hydroxide and calcium nitrate ...
-
bioRxiv - Bioengineering 2020Quote: ... and chondroitin sulfate derived from shark cartilage (Sigma-Aldrich) in 0.05 M acetic acid (Fig ...
-
bioRxiv - Neuroscience 2021Quote: Morphine sulfate pentahydrate (Sigma-Aldrich, St. Louis, MO USA) was dissolved in sterilized physiological saline (0.9% ...
-
bioRxiv - Microbiology 2019Quote: ... heparan sulfate sodium salt from bovine kidney (H7640) (Sigma). Lipofectamine® 3000 Transfection Kit were obtained from Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: Copper(II) sulfate pentahydrate (Sigma-Aldrich, St. Louis, MO); 1,10-Phenanthroline (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... Hybridization mix contained hybridization buffer (10% Dextran sulfate Sigma D8906 ...