Labshake search
Citations for Millipore Sigma :
6201 - 6250 of 10000+ citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... cells were fixed with 4% formaldehyde (Sigma-Aldrich) and processed for immunofluorescence in the wells ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by cold 4% paraformaldehyde (PFA, Sigma, USA) in PBS as a fixative ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4 μM antimycin A (Sigma-Aldrich, A8674) in combination with 4 μM rotenone (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng/mL IL-4 (Sigma, I1020). The cells were cultured for 72 hours at 37°C in a 5% CO2 incubator.
-
bioRxiv - Cell Biology 2024Quote: ... Detection was performed by ECL (GS009-4; Millipore) solution and imaged using the Tanon5200 detection system finally ...
-
bioRxiv - Cancer Biology 2024Quote: ... Propidium Iodide (25535-16-4, Sigma-Aldrich, Belgium), Cholera Toxin Subunit B (Recombinant ...
-
bioRxiv - Cancer Biology 2024Quote: ... they were fixed with 4% paraformaldehyde (Sigma-Aldrich) for 30 min at RT and then permeabilized with a solution of 0.5% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse arteries were fixed in 4% formaldehyde (Sigma) for 20 minutes at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were fixed with 4% PFA (Sigma-Aldrich) in PBS for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... After fixation with 4% paraformaldehyde (PFA, Sigma, USA) for 10 min and two additional washes with PBS for 5 min each ...
-
bioRxiv - Biochemistry 2024Quote: ... Chilled lysis buffer containing 4% Sodium deoxycholate (Sigma) and 100 mM Tris-HCl pH 8.5 was added such that total volume is about 600 μl ...
-
bioRxiv - Bioengineering 2024Quote: ... Carbonyl cyanide 4- (trifluoromethoxy)phenylhydrazone - FCCP (Sigma-Aldrich) 1.25 μM ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 ng/ml PDGF (Sigma Catalogue No. SRP3228)] ...
-
bioRxiv - Genetics 2024Quote: ... 4 U calf intestinal alkaline phosphatase (Sigma, 524572), 0.1 U phosphodiesterase I (US Biological ...
-
bioRxiv - Immunology 2024Quote: ... mice received 30 mg/l 4-deoxypyridoxine (Sigma) combined with 1 g/L sucrose or 1 g/L sucrose alone in the drinking water 3 days before IL-25 injection.
-
bioRxiv - Pathology 2024Quote: ... cells were fixed with 4% paraformaldehyde (Sigma-Aldrich) for 30 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... mounted with Mowiol® 4-88 (Sigma-Aldrich) and examined on Leica STELLARIS confocal microscope (Leica Microsystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... by treatment with 500nM 4-hydroxytamoxifen (Sigma Aldrich).
-
bioRxiv - Neuroscience 2021Quote: ... for 3 h followed by ATP (2 mM, Sigma Aldrich, A6419-5g ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit polyclonal anti-PCSK1 (PC1/3) (1:1000, Sigma, #SAB1100415), rabbit polyclonal anti-TSSC1/EIPR1 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 200 μM 3-isobutyl-1-methylxanthine (IBMX; Sigma), and their cumulus cells were removed by gentle pipetting ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich # I5879), 1 μM rosiglitazone (Cayman Chemical # 71742) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were blocked and simultaneously permeabilized with 3% BSA (SIGMA) and 0.2% Triton X-100 (SIGMA ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were subsequently blocked and permeabilized with 3% BSA (SIGMA) and 0.2 w/v % Saponin (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... or 3 µg/cm2 poly-L-lysine (Sigma-Aldrich, P6407) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x Phosphatase inhibitor cocktail 2 and 3 from Sigma-Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... and then blocked with 3% (w/v) BSA (Sigma-Aldrich) and 0.05% (v/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-15 µM MG132 (Z-Leu-Leu-Leu-al, Sigma) was added to the media for the indicated hours prior to cell lysis/fixation ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Caspase-3 antibody (Sigma USA, Dubey and Tapadia, 2017) was used at a dilution of 1:100 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 30 μL D2O with 3%TPS (Sigma Aldrich, 450510) and transferred in a standard 5 mm NMR tube (Wilmad-LabGlass ...
-
bioRxiv - Biophysics 2022Quote: ... 250 μM 3-isobutyl-1-me-thylxantine IBMX (Sigma-Aldrich), 100nM cortisol (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 1X Phosphatase inhibitor cocktails 2 and 3 (Sigma P5726, P0044), and 1X Protease inhibitor tablets (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and dispase-II (3 mg/mL, Cat# D4693, Sigma-Aldrich) for 60 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-Partitioning-defective 3 (Par3) (Sigma, 07-330, 1:1000), anti-Parvin (Cell signaling ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... DL-Serine Hydroxymate (SHX, Sigma CAS Number 55779-32-3), an inhibitor of seryl-tRNA synthetase which triggers the stringent response and prevents new rounds of replication ...
-
bioRxiv - Bioengineering 2022Quote: ... 121 mg of N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide ( EDC) (Sigma) and 28 mg of RGD peptide ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3:1 mixture of random hexamers/OligodT (Sigma-Aldrich), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μL of 1 mg/mL RNase A (Sigma R6148) and 3 μL of 20 mg/mL Proteinase K (NEB EO0491 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% murine plasma and 10 mM HEPES (Sigma) and left to settle for 45 minutes in the incubator at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Biophysics 2019Quote: ... then bound proteins were eluted with 3 mM desthiobiotin (Sigma) or 50 mM D-biotin (CHEM-IMPEX ...
-
bioRxiv - Neuroscience 2019Quote: ... the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich, Ref. #TRCN0000012392) or the shRNA control (dsRed2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Phosphatase Inhibitor Cocktail no.2 and no.3 (Sigma). Following manufactures recommendations ...
-
bioRxiv - Physiology 2019Quote: ... and 100 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich) was added to elicit a maximal cAMP response ...
-
bioRxiv - Immunology 2019Quote: ... and incubated in blocking buffer (3% BSA (#A7906, Sigma, USA) in PBS supplemented with 0.1% Triton X-100 (#9002-93-1 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 mM of HCL (Millipore Sigma, cat no. HX0603-3), and 0.5 mM of iron (II ...
-
bioRxiv - Immunology 2019Quote: The macrophages were activated by 3 μg/mL LPS (Sigma) and 100 pmol IFN-γ for 6 hrs ...