Labshake search
Citations for Millipore Sigma :
6101 - 6150 of 10000+ citations for Mouse anti Plasmodium falciparum HRP 2 antibody M302 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti GFAP (1:1,000; Millipore, Cat#MAB5628), rhodamine phalloidin (1:1,000 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse monoclonal anti-FLAG [M2] (Sigma Aldrich, #F1804) diluted at 1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... or mouse anti-NeuN (MAB377, 1:10,000, Millipore) in PBS with 0.3% Triton X-100 and 3% NGS at RT for 24 h ...
-
bioRxiv - Pathology 2023Quote: ... mouse monoclonal anti-tubulin (Sigma, T6074, 1:40000), rabbit polyclonal anti-Cd31 (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... mouse mAb 9D5 anti-dsRNA (3361, EMD Millipore) 1 in 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Vinculin (1:1000, Sigma, V-9131), mouse anti-TRIP6 (1:1000 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mouse anti-β-actin (Sigma, A5411, 1:10000), mouse anti-PSD95 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse Anti GAPDH (MAB374, 1:300, Millipore) control antibodies were used to probe the membrane.
-
bioRxiv - Microbiology 2023Quote: ... mouse anti-AFP (1:1000) from Sigma-Aldrich, mouse anti- ALB (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and mouse anti-tubulin (Sigma-Aldrich, 1:10,000) antibodies at 4 °C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... and mouse anti-NeuN (RRID:AB_2298772, Millipore Sigma MAB377). After rinsing in PBS 3X ...
-
bioRxiv - Plant Biology 2024Quote: ... mouse anti-Tubulin (Sigma T5168, dilution 1:500,000). HRP-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch #715-035-150 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse anti-Flag M2 (1:20,000; Millipore Sigma), Mouse anti-V5 (1:10,000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse anti-Flag (1:20,000; M2, Millipore Sigma), Mouse anti-β-galactosidase (JIE7 ...
-
Localization of Cadherins in the postnatal cochlear epithelium and their relation to space formationbioRxiv - Cell Biology 2024Quote: ... mouse anti-phosphoTyrosine (1:250, zms1b282, Sigma-Aldrich), anti-Cofilin (1:250 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-β-actin (Sigma, A1978, 1:100,000), mouse anti-Vinculin (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-GFAP (Millipore Sigma #G3893, 1:500), rabbit anti-Iba1 (Fujifilm Wako #019-19741 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and anti-mouse Minus (cat#DUO92004, Sigma-Aldrich) at 37°C for 1 hr ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... or anti-mouse (For MAP2: Sigma Aldrich; SAB4700503) IgG secondary antibody for 2 h at room temperature in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-Flag (1:1000, Sigma, cat. F1804), rabbit anti-ANT1/2 (1:1000 ...
-
bioRxiv - Genetics 2024Quote: ... mouse anti-c-Myc (Sigma-Aldrich, cat. # M4439), rabbit anti-GFP (Abcam ...
-
bioRxiv - Developmental Biology 2024Quote: ... and mouse anti-FLAG (Sigma F1804; 1:1000). The secondary antibody used was HRP-conjugated goat anti-mouse IgG (Jackson Lab 115-035-003 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1:4000 mouse anti-Flag (Millipore Sigma #F3165), 1:2500 mouse AC133-1 (Miltenyi #130-111-756) ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-VGluT1 (1:2000, Sigma cat. #MAB5502), and guinea pig anti-VGluT2 (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-alpha-tubulin (Sigma-Aldrich, #T6199, RRID:AB_477583), rabbit anti-beta-tubulin (abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-pan-cadherin (Sigma-Aldrich, #C1821, RRID:AB_476826), rat anti-PH3 (abcam ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-beta-Tubulin 1:5000 (T5201, Sigma) and secondaries goat anti-guinea pig-HRP 1:10000 (SA00001-12 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse monoclonal anti-NeuN (1:500; Millipore; MAB377), goat anti-ChaT (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-CSPG (1:200, Sigma-Aldrich, C8035), mouse anti-fibronectin (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-GluA2 (Sigma-Aldrich, #MAB397, 1:1000) ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-βactin (Sigma-Aldrich, #A5316, 1:5000); mouse anti-HA (BioLegend ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-Nestin (Millipore catalog #MAB5326; 1:250), and/or rabbit anti-PARD3 (Novus Biologicals ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse monoclonal anti-betaTubulinIII (1:10,000; Sigma) antibodies for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-Tau (Millipore used at 1/1000), mouse anti-GAPDH (Millipore used at 1/5000) ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-GAPDH (Millipore used at 1/5000). Alexa Fluor and other secondary antibodies were from ThermoFisher and Jackson ImmunoResearch and all were used at a dilution in between 1/1000 and 1/4000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Anti-Spectrin (1:1000 dilution [mouse]; Millipore # MAB1622), Anti-Rpt3 (1:100 dilution [mouse] ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse anti-FLAG (1:1000, Sigma-Aldrich).
-
Braf-mutant Schwann cells divert to a repair phenotype to induce congenital demyelinating neuropathybioRxiv - Developmental Biology 2024Quote: ... or mouse monoclonal anti-GAPDH (#MAB374; Merck Millipore). After washes ...
-
bioRxiv - Microbiology 2024Quote: ... mouse anti-EF1α (1: 40 000, Merck Millipore), anti-BrdU clone B44 (1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse anti-β-actin (1:10,000; Sigma-Aldrich) was used as an internal loading control ...
-
bioRxiv - Microbiology 2024Quote: ... mouse monoclonal anti-myc (1:100, 9E10 Sigma), rabbit anti-IMC3 (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-GFAP (1:2000; #MAB3402, RRID:AB_94844, Millipore). Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-γ-tubulin (1:250, Sigma, T6557), rabbit anti-pericentrin (1:1,000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-FLAG-M2 (Sigma, F1804, 1:1,000), mouse anti-γ-tubulin (1:250 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and mouse anti-puromycin (MABE343, 1:500, Millipore). Detection of newly synthesised MBP and MOBP through PLA was performed according to the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2020Quote: ... The other half of the conditioned media was subjected to IgG pull-down step (2 µl for 9 ml CM) (Anti-mouse IgG monoclonal Ab; Sigma-Aldrich; Cat#M9144) which was used as a negative control for this assay ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were incubated in a triton-TBS containing 2% NGS and a mouse anti-oxytocin polyclonal antiserum (MAB5296, Millipore, Burlington, MA; 1:300) for 72 hrs at 4 °C ...
-
bioRxiv - Physiology 2021Quote: ... HRP signal was visualized using Crescendo Western HRP substrate (EMD Millipore) and an Amersham Imager 680 ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Pathology 2021Quote: ... 1 μg/mL natural mouse laminin and 2 μM Arabinosylcytosine (Sigma-Aldrich). 48 hours later NSM medium was fully exchanged ...