Labshake search
Citations for Millipore Sigma :
6101 - 6150 of 10000+ citations for 6 Ethyl 1H indole 2 3 dione 3 O 4 4 4 trifluoro butyl oxime since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4 °C with purified collagen I from human placenta (Sigma), gelatin from bovine skin (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were incubated with lentivirus and 4 µg/ml polybrene (Sigma, Cat#TR-1003) for 12 h ...
-
bioRxiv - Biophysics 2023Quote: ... 0.05% Igracure 2959 and 4% Acrylic-acid NHS/DMSO (10 mg/ml, A8060 Sigma) in milliQ water ...
-
bioRxiv - Cell Biology 2023Quote: ... fixed with 4% PFA for 15min and incubated with 1μg/ml DAPI (Sigma, UK) in PBS for 5min to stain the nucleus ...
-
bioRxiv - Biochemistry 2024Quote: ... pH 7.4) supplemented with 10 mM 4-Chloro-7-nitrobenzofurazan (NBF-Cl, Sigma, #163260) and 1% Protease Inhibitor using TissueLyser II (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4 °C with purified collagen I from human placenta (Sigma), gelatin from bovine skin (Sigma ...
-
bioRxiv - Systems Biology 2024Quote: ... Samples containing 4 µg of peptides were de-salted using C18 Zip-tips (Millipore) and resuspended in 20 µl of 2.5 % (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were detached using a solution of 4 mg/ml Lidocaine hydrochloride monohydrate (Sigma) and 5 mM EDTA (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... Membrane was then incubated overnight at 4°C with antibodies against GFAP (Millipore, AB5541), Iba-1 (Wako ...
-
bioRxiv - Plant Biology 2024Quote: ... Fixation solution was prepared by mixing 4% (w/v) Paraformaldehyde (PFA, Sigma-Aldrich 158127) with 0.01 M PBS (pH 7.4 ...
-
bioRxiv - Genetics 2024Quote: Cultured chondronoids were fixed overnight at 4 °C in 10% neutral-buffered formalin (Millipore), washed in 70% ethanol ...
-
bioRxiv - Immunology 2024Quote: ... T cells were cultured for 4 hours with PMA (50 ng/ml; Sigma-Aldrich), ionomycin (500 ng/ml ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were fixed overnight at 4°C in 10% Neutral Buffered Formalin (HT501125, Sigma) and embedded in paraffin following standard processing (45 min ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 ng/L 3,3′,5-triiodo-L-thyronine sodium salt (T6397, Sigma-Aldrich). The cells were cultured in a 75 cm2 flask (658175 ...
-
bioRxiv - Cell Biology 2024Quote: The following primary antibodies were used overnight at 4°C: anti-FLAG (M2, Sigma), 1:250 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µm sections were stained with H&E (Sigma-Aldrich, St. Louis MO, USA), digitized (Nanozoomer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100mg/mL penicillin,100mg/mL streptomycin and 5 μM 4-hydroxytamoxifen (H7904 Sigma, UK). For all experiments ...
-
bioRxiv - Biophysics 2024Quote: ... and 0.001% (v/v) DSS (4,4-Dimethyl-4-silapentane-1-sulfonic acid) (Sigma-Aldrich). 2D 1H-15N TROSY-HSQC NMR spectra of TRAP samples loaded in Wilmad® 5 mm 541-PP NMR tubes (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by the same volume of ice-cold 4% paraformaldehyde (PFA) (1.04005.1000, Merck Millipore) in 0.1 M phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... were killed by transcardial perfusion with PBS followed by 4% paraformaldehyde (Sigma-Aldrich, UK). Following perfusion-fixation ...
-
bioRxiv - Microbiology 2024Quote: ... slides were fixed with 4% paraformaldehyde and stained with DAPI (10 ug/mL; Sigma) for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: ... and 12.5 µl of the fluorogenic substrate 4-methylumbelliferyl β-D-galactoside (Sigma-Aldrich) was incubated at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... overnight incubation at 4°C with anti-γH2AX antibody (Millipore, Cat No: 05-6361) diluted 1:200 in Dako antibody diluent (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed using 4% paraformaldehyde (PFA) and permeabilized with 0.3% saponin (Sigma-Aldrich). The cells were then stained with the desired antibody in PBS containing saponin for 2 hours at 4oC ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed with 4% formaldehyde and permeabilized with 0,25% Triton (T8787; Sigma). Cells were firstly intracellularly stained with primary rabbit anti-human H2AX antibody (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 4 hours with Brefeldin A (1 μg/mL; Sigma-Aldrich). CD4+ T cells stimulated for three hours with PMA (50 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... brains were immediately immersed in cold 4% paraformaldehyde (Sigma-Aldrich, St Louis, MO, USA) in 0.1 M phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... spun at 2.000 g for 5 min at 4°C and Benzonase (Sigma-Aldrich) added at a concentration of 50U/mL to supernatants for 30 min at 37°C ...
-
bioRxiv - Genetics 2022Quote: Ethyl methanesulfonate (EMS, Sigma) mutagenesis of the wild-type reference strain N2 (HR1988 ...
-
bioRxiv - Genetics 2022Quote: ... Ethyl alcohol (Sigma Aldrich) beneath the agar to achieve a final EtOH concentration of 400 mM ...
-
bioRxiv - Cancer Biology 2022Quote: ... ethyl ester (TMRE, Sigma) or 100nM MitoTracker Green (MTG ...
-
bioRxiv - Neuroscience 2022Quote: ... the noradrenergic neurotoxin N-(2-Chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP4) (10 mg/kg, i.p., Sigma-Aldrich) or vehicle (0.9% saline ...
-
bioRxiv - Biochemistry 2019Quote: ... The culture was supplemented with 2 mM O-Phospho-L-serine (Sigma) at OD600nm = 0.3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... or a scrambled 2⍰-O-Methyl RNA sequence (both custom-made, Sigma). The cells were harvested in PBS ...
-
bioRxiv - Immunology 2022Quote: ... Perturbation profiling of the use of metabolic pathways by T cells was achieved by the addition of oligomycin (O4876; 1 µM), Carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP, C2920; 2 µM) and rotenone (R8875; 1 µM - all from Sigma Aldrich, St. Louis, MO). Metabolic parameters were then calculated based on the following formulas:
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... airway mechanics were measured by challenging pigs to increasing concentrations of methacholine hydrochloride (MeCh) (0, 0.5, 1, 2, 4, 8, 16, and 32 mg/mL) (Sigma-Aldrich, St. Louis, MO, USA) via an Aeroneb™ nebulizer (Aerogen Ltd ...
-
bioRxiv - Molecular Biology 2019Quote: ... and immunoprecipitated overnight at 4 °C with 2 µg affinity-purified rabbit anti-PKM2 antibody raised against a C-terminal peptide (Sigma cat. # SAB4200105, Lot #030M4874) pre-coupled to Dynabeads sheep M-280 anti-rabbit IgG beads (LifeTech) ...
-
bioRxiv - Genetics 2019Quote: ... skimmed milk in PBS at the following concentrations for 2-20 h at 4°C (anti-Srs2, Santa Cruz sc-1191, 1:2000; anti PSTAIR, Sigma P6962, 1:2500). Membranes were washed 3x in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were used for purification of recombinant proteins by 2 h incubation with GST-agarose beads at 4 °C according to manufacturer’s protocol (Sigma Aldrich, St. Louis, USA, G4510). SDS-PAGE electrophoresis was used to check level of expression and purity of purification.
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were then stained with a 1X crystal violet solution for 20 minutes at RT (2% crystal violet, Sigma; 20% ethanol; 4% formaldehyde, Merck). Plates were washed with clear water and plaques were counted manually ...
-
bioRxiv - Microbiology 2023Quote: ... and then cells were washed with PBS supplemented with bovine serum albumin at 1 g/l and incubated with 12 concentrations of mACE2 (4 pM to 10 nM, dilution series with factor 2) and 20 nM bilirubin (Sigma-Aldrich, Cat# 14370-1G). Performance comparison with Expi293F cells produced ACE2 peptidase domain (residues 18–617 ...
-
bioRxiv - Immunology 2023Quote: ... then livers were harvested and placed in 2% paraformaldehyde for 24 hours at 4°C then placed in 30% sucrose (Sigma-Aldrich Cat. No. S1888) in PBS for 48 hours at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane pellets were solubilized in 4 mL TBS buffer (50 mM Tris-HCl, 150 mM NaCl, pH = 7.4) with 2% Triton X-100 (Sigma-Aldrich, St Louis, MO, USA). The solubilized membrane-fraction was loaded on a column containing 1 mL anti-DYKDDDDK (Flag ...
-
bioRxiv - Biochemistry 2023Quote: ... The blots were probed with the following primary antibodies at room temperature for 1-2 hours or at 4 ℃ overnight: anti-GAPDH (Millipore, #MAB374, 1:5,000 dilution), anti-Flag M2 (Sigma ...
-
bioRxiv - Zoology 2023Quote: ... All wells were then washed with embryo media three times before being incubated on an orbital incubator shaker at 130 rpm and 28°C for 15-20 minutes in media containing 0.01% 2-[4-(dimethylamino) styryl]-1-ethylpyridinium iodide (DASPEI, Sigma Aldrich; cat. #3785-01-1) to selectively stain live neuromast hair cells ...
-
bioRxiv - Molecular Biology 2023Quote: The cells were then incubated at 37°C for 4 h in the presence of 25 μM 5-iodo-2′-deoxyuridine (IdU; Sigma-Aldrich, St. Louis, MO). After washing cells with PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... and SIX6 with an internal TEV protease cleavage site for pro-domain removal were processed with 2 to 4 units of thrombin from bovine plasma (600-2,000 NIH units/mg protein) (Sigma-Aldrich Inc., St. Louis, USA) per mg of protein at 4°C or TEV protease (produced in-house ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...