Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for Mouse Liver Expressed Antimicrobial Peptide 2 LEAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 2% glycerol) and then eluting by shaking with 15 μL of 100 μg/μL of 3X FLAG peptide (Sigma-Aldrich, F4799) in the original lysis buffer for 30 min at 4°C.
-
bioRxiv - Cell Biology 2023Quote: ... and SKR-2-containing protein complexes were eluted overnight in 100 µl of the lysis buffer containing 2 mg/mL of 3xFlag peptide (Sigma F4799). Eluted protein samples were digested with trypsin and analyzed by MudPIT in the Mass Spectrometry and Proteomics Facility at Johns Hopkins School of Medicine.
-
bioRxiv - Immunology 2022Quote: ... IL-10 and TNF-α were determined in 24 h culture supernatant of UNT control and treated MOs using respective ELISA kits (Sigma-Aldrich kit, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Pathology 2021Quote: ... 1 μg/mL natural mouse laminin and 2 μM Arabinosylcytosine (Sigma-Aldrich). 48 hours later NSM medium was fully exchanged ...
-
bioRxiv - Cancer Biology 2019Quote: ... α-tubulin mouse (1:10000 WB, clone B-5-1-2, Sigma-Aldrich), p120 catenin mouse (1:1000 WB ...
-
bioRxiv - Biophysics 2022Quote: ... and mouse myotubes were treated with thapsigargin (2 μg mL-1; Sigma) for 10 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-glutamate receptor 2 (mouse anti-GluR2 IgG2a; Millipore; 1:2000). Sections were then washed with PBS and incubated in Alexa Fluor-conjugated fluorescent secondary antibodies (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal against alpha-tubulin (1:1000; b5-1-2, Sigma, T6074). Actin was stained using 100 nM of phalloidin-iFluor488 for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
SIMON, an automated machine learning system reveals immune signatures of influenza vaccine responsesbioRxiv - Immunology 2019Quote: ... working concentration 0.2ug/ml/peptide) and 24 peptides with HLA-A*0201-specificity (9-10mers, Sigma Aldrich) generated against influenza proteins (hemagglutinin ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following antibodies used for immunocytochemistry as described above are as follows: mouse monoclonal antibody to FLAG peptide (Sigma #F1804, 1:500), sheep polyclonal to TGN46 (Biorad #AHP500G ...
-
bioRxiv - Molecular Biology 2020Quote: The following antibodies used for immunoblot as described above are as follows: mouse monoclonal antibody to FLAG peptide (Sigma #F1804, 1:5000), Rabbit monoclonal to c-Myc (abcam #ab32072 ...
-
bioRxiv - Immunology 2023Quote: ... Antibody binding to N protein was detected using conventional two-step ELISA with an HRPO-conjugated anti-mouse or anti-rat Fc antibody (Sigma Aldrich cat # A9309). All assays included a standard curve of mouse neutralising S1 antibody and mouse anti-N antibody (Sino Biological) ...
-
bioRxiv - Immunology 2020Quote: ... Both C3d constructs were expressed in the Escherichia coli BL21(DE3) (Sigma Aldrich) or Shuffle T7 (NEB ...
-
bioRxiv - Biophysics 2021Quote: All TwcK sample variants were expressed in E.coli Rosetta (DE3) cells (Merck Millipore) and grown in LB media containing 25 µg/mL kanamycin and 34 µg/mL chloramphenicol ...
-
bioRxiv - Biochemistry 2020Quote: ... SUN1 and KASH constructs were co-expressed in BL21 (DE3) cells (Novagen®), in 2xYT media ...
-
bioRxiv - Biophysics 2021Quote: all the WWOX constructs were expressed in Escherichia coli BL21 pLysS cells (Novagen). Cells were grown in 2× YT medium ...
-
bioRxiv - Cell Biology 2021Quote: ... All Kif7-CCs and Kif7-SCC were expressed in BL21 (DE3) Rosetta (Millipore) E ...
-
bioRxiv - Cell Biology 2021Quote: Thermophilic Odinarchaeota proteins were expressed in Rosetta (DE3) pLysS Escherichia coli cells (Novagen). Cultures were grown at 37°C to an OD600 of 0.3 then cooled to 25°C and further grown to an OD600 of 0.6 and induced overnight with 0.33 mM IPTG ...
-
bioRxiv - Neuroscience 2020Quote: ... the proteins were expressed in Escherichia coli strain BL21(DE3) (Novagen, Darmstadt, Germany) and cells were lysed with a cell disruptor (Avestin ...
-
bioRxiv - Biophysics 2021Quote: ... Protein was expressed as a His6-tag fusion in BL21(DE3) trxB (Novagen) using autoinduction24 ...
-
bioRxiv - Molecular Biology 2019Quote: ... plasmids for different Cas9 proteins were expressed in Escherichia coli Rosetta2 (DE3) (Novagen). The protein expressing Rosetta2 (DE3 ...
-
bioRxiv - Genetics 2019Quote: Recombinant proteins were expressed in Escherichia coli BL21(DE3)pLys using pET28a+ (Novagen) and purified using Ni-Sepharose affinity medium (GE Healthcare ...
-
bioRxiv - Cancer Biology 2020Quote: ... The antibodies were transiently expressed in HEK 293A cells following polyethylenimine (Sigma-Aldrich) transfection (Sherbenou et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant genes were expressed in Escherichia coli strains BL21 (DE3) or TUNER (Novagen), containing the appropriate recombinant plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant genes were expressed in Escherichia coli strains BL21 (DE3) or TUNER (Novagen), containing the appropriate recombinant plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... All proteins were expressed in Escherichia coli BL21(DE3) Rosetta/pLysS strain (Novagen). Cells were grown in LB medium supplemented with 10% (w/v ...
-
bioRxiv - Cell Biology 2019Quote: All proteins were expressed and purified from E.coli Rosetta (DE3) Competent Cells (Novagen). Details of individual constructs and their expression plasmids are detailed in the plasmids section ...
-
bioRxiv - Cell Biology 2022Quote: ... The expressed GST-fusion protein was absorbed to glutathione-Sepharose 4B (Sigma-Aldrich) followed by extensive washing with phosphate buffered saline (PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... the proteins were expressed in Escherichia coli strain BL21(DE3) (Novagen, Darmstadt, Germany) and cells were lysed with a cell disruptor (Avestin ...
-
bioRxiv - Plant Biology 2023Quote: ... The over-expressed recombinant proteins were then coupled to CNBr-activated Sepharose (Sigma) at a ratio of 2.5 mg protein to 1 ml Sepharose slurry as described by the manufacturers.
-
bioRxiv - Developmental Biology 2020Quote: ... minced livers were incubated in a solution containing 0.0125% (mg/ml) collagenase (SIGMA, C9407), 0.0125% (mg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: Liver tissue and cells were lysed in 1 ml of TRI Reagent (Sigma #T9424) and incubated for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Livers were processed in 5 ml of 0.1 % Igepal CA-630 (Sigma-Aldrich, I8896) in PBS using the gentleMACS™ C Tubes (Miltenyi Biotec ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Snap frozen liver tissue (30-40 mg) was homogenised in radioimmunoprecipitation buffer (Sigma Aldrich). Liver homogenate (20 μg ...
-
bioRxiv - Molecular Biology 2022Quote: ... Frozen liver sections were subjected to Oil Red O (O9755; Sigma-Aldrich, MO, USA) staining to determine lipid droplet accumulation ...
-
bioRxiv - Physiology 2023Quote: Liver tissue lysates were prepared by solubilizing the tissue in RIPA buffer (Sigma, USA) containing protease/phosphatase inhibitor (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... TR from rat liver (TrxB) was obtained from Sigma-Aldrich (St. Louis, MO, USA). pGEX-4T-1 cells were obtained from GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: Murine livers were removed and fixed overnight in 10% neutral-buffered formalin (Sigma-Aldrich) at RT ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was extracted from frozen liver using TriZOL reagent (Sigma Aldrich, Irvine, UK) to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Liver sections were blocked in 5% bovine serum albumin (BSA, Sigma Aldrich #A3294-500G) + 0.25% Triton X-100 (Sigma Aldrich #X100-100ML ...
-
bioRxiv - Cancer Biology 2021Quote: ... and GM-CSF levels were quantified using ELISA kits pre-coated with indicated capture antibodies per manufacturer’s instructions (Sigma). IL-6 levels were preliminarily detected using a Q-Plex Human cytokine screen (16-plex ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 individual peptides (2 μg/ml) or blank control (complete medium with DMSO) onto sterile nitrocellulose MSIP 96-well plates (Millipore, Bedford, MA) coated with capture antibodies against mouse IFN-γ ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Immunology 2020Quote: ... the membranes were incubated with the appropriate horseradish-peroxidase conjugated secondary Ab (1:5000 in TBST + 2% BSA; 2 h at room temperature; anti-mouse A4416 and anti-rabbit A0545, Sigma). The immunoreactivity was detected by ECL reagents (Amersham) ...
-
bioRxiv - Bioengineering 2022Quote: ... Peanut-specific IgG1 was detected using goat anti-mouse IgG1-HRP conjugated (Southern Biotechnology Associates) and substrate TMB liquid substrate system for ELISA (Sigma-Aldrich, St. Louis, MO). The plates were read in an ELISA plate reader at 405 nM (IgE ...