Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for Mouse DEFB15 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: The PLK0 lentivirus expressing scramble (SHC002) and UBC9 (NM_003345.3-545S1C1) shRNA expressing vectors were from Sigma. Viral particles were produced and used to transduce HL60 cells as described previously (30) ...
-
bioRxiv - Cancer Biology 2022Quote: ... CGGGACAATGTGTATTACTAT) or non-targeting shRNA (CTL) in the pLKO.1-puro vector (MISSION library, Sigma-Aldrich), and selection with 2 μg/mL puromycin 3-7 days after infection ...
-
bioRxiv - Microbiology 2020Quote: THP-1 were transduced with lentivirus expressing shRNA targeting Rab29 (TRCN0000299449; TRCN0000303685; TRCN0000381042; TRCN0000303621 Sigma-Aldrich) or Rab32 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLKO.1-puro Vector empty or containing the target shRNA sequence for PIKCδ (Mission Library, Sigma) were transfected using 4-D electroporator (LONZA) ...
-
bioRxiv - Immunology 2019Quote: ... A PLKO.1 vector encoding shRNA for a negative control (Sigma-Aldrich, St. Louis, MO, USA) or a specific target molecule (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... A PLKO.1 vector encoding shRNA for a negative control (Sigma-Aldrich, St. Louis, MO, USA) or a specific target molecule (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... shRNA specific for hERG1b 5’-CCACAACCACCCTGGCTTCAT-3’ and its respective control were purchased from Sigma-Aldrich. For heterologous expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the transcription of shRNAs was induced with 2.0 μg/mL doxycycline hyclate (Sigma-Aldrich, #D9891).
-
bioRxiv - Cell Biology 2023Quote: ... the sequence of the shRNA targeting 3UTR of human NRF2 gene was obtained from Sigma Aldrich (TRCN0000007555 ...
-
bioRxiv - Biochemistry 2024Quote: ... lentivirus was generated by cotransfection of pLKO.1 with shRNA sequences specific to ACSS2 (TRCN0000045563, Millipore), pCMV-dR8.2,and pMD2.G plasmids into HEK293T cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... The MISSION shRNAs in the pLKO.1 lentiviral vector with a puromycin resistance gene were from Sigma. Product identification numbers for each shRNA are listed – NT-sh ...
-
bioRxiv - Cell Biology 2020Quote: ... A549 cells were infected with PKCε shRNA Mission® lentiviral transduction particles (catalog # SHCLNM_005400) from Sigma-Aldrich according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Nav1.5-shRNA cells and cells non-targeting shControl cells were maintained in G418 (4 μl/ml, Sigma), blasticidin (2 μl/ml ...
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-puro lentiviral vectors expressing shRNAs targeting FASN (shFASN_1: NM_004104.x-1753s1c1 and shFASN_2: NM_004104.x-3120s1c1) were purchased from Sigma-Aldrich. An mCherry-LC3B lentiviral vector was kindly provided by Dr ...
-
bioRxiv - Neuroscience 2021Quote: ... or non-targeting control in the pLKO.1 vector were obtained from the Mission shRNA Library (Sigma).
-
bioRxiv - Cell Biology 2021Quote: NFIC expression was interfered in 266-6 cells using Mission shRNA lentiviral constructs purchased from Sigma-Aldrich. Nfic sh1 [TRCN0000374154 targeting ACAGACAGCCTCCACCTACTT) ...
-
bioRxiv - Cell Biology 2021Quote: ... The AURKA-specific shRNA (SHCLNG-NM_003600) and a non-targeting control (SHC002) were purchased from Sigma-Aldrich. Plasmids and shRNAs were transfected by the calcium phosphate method or with Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... as well as pLKO.1 (50) containing either non-targeting or IFIT1 shRNA (Sigma, TRC1, Clone: TRCN0000158439). Huh7 cells were transduced with the indicated shRNA expressing lentivirus then selected with 2 μg/ml puromycin (Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... All lentiviral vectors (pLKO.1) expressing shRNAs used for knockdown of host proteins were purchased from Sigma.
-
bioRxiv - Genomics 2019Quote: The MISSION pLKO.1-puro human TDP-43 (TRCN0000016038) and control shRNAs (Sigma Aldrich SHC007 and SHC016) were used to produce lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: MISSION TRC shRNA lentiviral library containing 80’000 lentiviral clones targeting 15’000 genes was purchased from Sigma-Aldrich. Cells (3,000 per well ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Molecular Biology 2021Quote: All lentivirus-based shRNA clones used for making the viral transduction particles were purchased from Sigma-Aldrich. pLKO.1-Puro vector targeting human PPARA or non-target vector as a control was used ...
-
bioRxiv - Microbiology 2021Quote: ... ICAM-1kd PLB985 cells were generated by lentiviral transduction with ICAM-1 specific shRNAs from Sigma (TRCN0000372478). EPCRkd PLB985 cells were generated by lentiviral transduction with EPCR specific shRNAs from Sigma (TRCN0000300553) ...
-
bioRxiv - Immunology 2020Quote: ... MISSION shRNA Lentiviral Transduction Particles against human CLPP (TRCN0000291174) or eGFP (RHS4459) were purchased from Sigma-Aldrich and Horizon Discovery respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Expression of either CAPN1 or CAPN2 was knocked down in U251N using shRNA purchased from Sigma-Aldrich (CAPN1 ...
-
bioRxiv - Cell Biology 2022Quote: shRNAs against APPL1 and EEA1 were selected from de Broad Institute GPP database and purchased from Sigma (MISSION TRC shRNAs purified plasmid DNA) ...
-
bioRxiv - Cancer Biology 2022Quote: pLKO.1-puro lentiviral vectors expressing shRNAs targeting HSP8A (shHSPA8_1: NM_006597.3-2040s21c1) and HSP90AA1 (NM_005348.x-1505s1c1) were purchased from Sigma-Aldrich. These vectors contain a puromycin antibiotic resistance gene for selection of transduced mammalian cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transduced MCF7 and HS5 cells with shRNA against CCDC88A (clone TRCN0000129915, Millipore Sigma, Burlington, MA, USA), preparing lentiviruses as described previously (87) ...
-
bioRxiv - Cancer Biology 2023Quote: An shRNA library targeting 284 pancreatic cancer related genes was generated using the pLKO vector backbone (Sigma). Each gene was targeted with 3-4 shRNA producing a library size of 1013 shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... As a control we used a shRNA against Luciferase (cat# SHC007, Sigma-Aldrich, Saint Louis, MO, USA). The following sequences were used as a shRNA target shRNA-Luciferase ...
-
bioRxiv - Cancer Biology 2023Quote: ... The LDHA shRNA vector (TRCN0000164922) was validated for 96% knockdown in HEK293T cells (Sigma, St. Louis, MO). Both vectors were packaged into lentiviral particles prior to transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral shRNA constructs in the pLKO.1-puro vector were purchased as glycerol stocks from Millipore Sigma. For shADAR1 ...
-
bioRxiv - Cell Biology 2024Quote: Stable MMP9 knockdown cell lines were generated using two independent shRNA sequences (CCACAACATCACCTATTGGAT and CAGTTTCCATTCATCTTCCAA; Sigma Aldrich). The transduced cells were selected using puromycin (Catalogue number CMS8861 ...
-
bioRxiv - Immunology 2020Quote: ... PD1kd 4T1 and AT3 cells were generated by lentiviral transduction with PD1 specific shRNAs from Sigma (TRCN0000097670-74). Control cells were transduced an empty vector (pLKO) ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentiviral particles for shRNA knockdown of NTRK2 were produced following transfection of the lentiviral packaging vectors (pΔ8.9 and VSV-g) and either the PIK3CA shRNA vector (TRCN0000197207; Sigma) or the control shRNA vector (SHCOO2 ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: shRNA Endo180 knock-down clones from 3T3 and CAFs were generated using lentiviral particles (Sigma, Supplementary Table 3). For siRNA knockdown ...
-
bioRxiv - Neuroscience 2021Quote: Ten days post induction of shRNA against TDP-43 with 1 μg/ml doxycyline hyclate (Sigma D9891-1G), SH-SY5Y cells were treated either with 100 μM cycloheximide (CHX ...
-
bioRxiv - Neuroscience 2021Quote: ... For induction of shRNA against TDP-43 cells were treated with 5 μg/mL Doxycyline Hyclate (Sigma D9891). After 3 days media was replaced with Neurobasal (Thermo ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shVCP (TRC0000004249) and shHER3 (TRCN0000218392) pLKO.1 constructs were from the Mission shRNA collection from Sigma-Aldrich. Lentivirus particles expressing shRNA against the gene of interest were generated by co-transfection with the VSV-G packaging and CDNL envelope plasmids (courtesy of Biplab Dasgupta ...
-
bioRxiv - Cancer Biology 2022Quote: For lentiviral production, shRNA clones targeting CAD (TRCN0000045910, TRCN0000045908) and DHODH (TRCN0000025868, TRCN0000025839) were purchased from Sigma-Aldrich, doxycycline inducible shRNA targeting DPYD (V2THS_84048 ...
-
bioRxiv - Immunology 2020Quote: ... Huh7 cells were transduced with the indicated shRNA expressing lentivirus then selected with 2 μg/ml puromycin (Sigma). After selection ...
-
bioRxiv - Cancer Biology 2019Quote: ... and lentiviral vectors: non-targeting control (PLK0.1) or p75NTR-targeting MISSION shRNA constructs (Sigma-Aldrich, TRCN0000058153 and TRCN0000058153). The medium was changed 8 hours post-transfection ...
-
bioRxiv - Molecular Biology 2019Quote: HCT116 cells were transfected with pLKO.1 vector expressing either an eIF6 targeted shRNA (CCGGGTGCATCCCAAGACTTCAATTCTCGAGAATTGAAGTCTTGGGATGCACTTTTT G, Sigma - TRC327700) or a control non-targeting shRNA (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: Four Lenti-pLKO.1-puro shRNA vectors that specifically targeted COL7A1 mRNA sequences were chemically synthesized (Sigma Aldrich) and included in viral particles:
-
bioRxiv - Biochemistry 2023Quote: ... HEK 293t cells were infected with commercially available Lentiviral particles for hTRMT2A KD and scrambled control cell line (MISSION® shRNA Lentviral Transduction Particles: scrambled control WT = SHC002V, KD1 = NM_182984.2-856s1c1, KD2 = NM_182984.2-1574s1c1; Sigma-Aldrich). Cells with stable integration of shRNA were selected as puromycin-resistant colonies ...
-
bioRxiv - Cancer Biology 2023Quote: METTL3 (sh1 and sh2) and Control shRNA in pLKO.1-TRC cloning vector were purchased from Sigma-Aldrich to generate stable METTL3-KD cells ...
-
bioRxiv - Neuroscience 2024Quote: For induction of shRNA against TDP-43 cells were treated with the following amounts of doxycycline hyclate (Sigma), and collected after 10 days:
-
bioRxiv - Biochemistry 2019Quote: The custom designed CompoZr® Zinc Finger Nuclease Plasmid targeted to exon 3 of the mouse ECH1 gene on chromosome 7 was obtained from Sigma. In-vitro transcription of the ZFN mRNA was performed following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid isolation was performed with GenElute plasmid miniprep kit (Sigma). All other standard DNA manipulation techniques such as analysis ...