Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: A monoclonal anti-α-tubulin (SIGMA, T5168, Clone B-5-1-2) was used in western blots as a loading control ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mg·ml-1 iodoacetamide and 5 U/l Salt Active Nuclease (Sigma) for 1 h at 4 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells were also treated with 1 μM 5-Aza-2’-deoxycytidine (Sigma) or 100 nM chaetocin (Cayman Chemical) ...
-
bioRxiv - Immunology 2022Quote: ... or α-Tubulin (clone B-5-1-2, Sigma-Aldrich, Cat#T5168). Primary antibodies were revealed with IRDye® 680 Goat anti-Mouse IgG or IRDye® 800CW Goat anti-Rabbit IgG (LI-COR ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-α-tubulin B-5-1-2 monoclonal primary (T5168, Sigma), followed by goat-anti mouse IRDye 680 goat anti-mouse IgG secondary antibodies (926-68070 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Phosphatase Inhibitor Cocktail 2 and 3 (Sigma-Aldrich)] ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase inhibitor 2 and 3 cocktail (Sigma) as previously described (26).1 μg/μl protein lysates in Laemmli sample buffer supplemented with 0.025 M DTT were boiled for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... with TM (2-3 mg/pregnant female) (Sigma) dissolved in corn oil (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma). Lysates were incubated at 4°C for 30 minutes and supernatants were collected after centrifugation at 20,000xG at 4°C for 15 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... (3) blocked in 2% Bovine Serum Albumin (Sigma) in PBS with permeabilization by 0.2% Triton X-100 (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 3 mM Mg(Ac)2 (Sigma-Aldrich, M5661), 10 mM Tris pH 7.8 (Invitrogen ...
-
Large-scale conformational changes of FhaC provide insights into the two-partner secretion mechanismbioRxiv - Biophysics 2022Quote: ... 3 mM tris(2-carboxyethyl)phosphine (TCEP, Sigma) was added to the detergent extract before ion exchange chromatography ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 (P5726) and 3 (P0044) from Sigma-Aldrich, St ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 (P5726) and 3 (P0044) from Sigma-Aldrich, St ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3′-dA (Sigma, 2 mM final concentration) were dissolved in G1.5 medium (Vitrolife) ...
-
bioRxiv - Immunology 2020Quote: ... and 2 mg Al(OH)3 (alum, Sigma) in saline on D0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphatase inhibitor 2 and 3 cocktail (Sigma-Aldrich), 2.5 mM MgCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) to release membrane proteins ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma)) and incubated on ice for 60 minutes ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) and precipitated proteins were eluted with 4x SDS sample buffer at 95 °C for 5 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg/ml 3-5kDa fluorescein dextran (Sigma) in 50% CM with 10 μM Y-27632 ...
-
bioRxiv - Cell Biology 2024Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma). Benzonase (Millipore ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2% Phosphatase inhibitor cocktail 3 (Sigma-Aldrich)] ...
-
bioRxiv - Cell Biology 2023Quote: ... EHMT1/2 inhibitor (Sigma-Aldrich, 3 mg/mL), SB747651A ...
-
bioRxiv - Cell Biology 2022Quote: ... and Phosphatase inhibitors cocktail 2 and 3 (Sigma). Lysed cells were harvested by scraping ...
-
bioRxiv - Molecular Biology 2023Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma). Benzonase (Millipore ...
-
bioRxiv - Microbiology 2023Quote: Cinnamaldehyde (CAD) (3-Phenylprop-2-enal; Sigma-Aldrich) minimum inhibitory concentration (MIC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Sodium 3-methyl -2-oxobutyrate (KIV) (Sigma) were used to prepare branched-chain ketoacid (BCKA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitors (cocktail 2 and 3, Sigma). Samples were then sonicate for 1 minute and a BCA assay was used to determine the protein concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... and phosphatase inhibitors cocktail 2 and 3 (Sigma) one ice for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitors cocktail 2 and 3 (Sigma). The cells were lysed for 30 to 45 minutes at 4°C followed by centrifugation at 14000 RPM for 40 minutes at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Molecular Biology 2021Quote: ... the pellet was lysed with 2% SDS and total mtDNA was extracted by phenol/chloroform/isoamyl alcohol (25:24:1) (Sigma). After precipitation the labeled DNA were denatured at 95 °C for 15 min and separated by 0.8% agarose gel electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Cell Biology 2020Quote: ... and 5-bromo-2-deoxyuridine (BrdU, Sigma) was added to the culture media at a final concentration of 10 μM for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... otherwise 2-5% DMSO (Sigma, Cat# D9170) were used instead ...
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (Sigma-Aldrich), 4-dimethylaminopyridine (DMAP ...
-
bioRxiv - Cancer Biology 2021Quote: BrdU (5-Bromo-2-deoxyuridine) (Millipore, 203806) was used to assess cell proliferation and the assay was performed in 96-well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-bromo-2’-deoxyuridine (BrdU) (Sigma, 10280879001) solution was peritoneally injected into live mouse at a concentration of 150mg/kg ...
-
bioRxiv - Biophysics 2022Quote: ... 2 or 5% (PEG-8000, Sigma Aldrich); iv ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-fluoro-2-deoxyuridine (Millipore cat. # 343333) was added at a concentration of 4 µM to prevent glial cell overgrowth ...
-
bioRxiv - Immunology 2021Quote: ... 5.5×10−5 M 2-mercaptoethanol (Sigma), 10mM HEPES (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... 5-Iodo-2-deoxyuridine (IdU; Sigma, 100uM) and puromycin (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dimethyl 2-oxoglutarate (5 mM; Sigma, 349631), and 3-Mercaptopicolinic Acid (5 mM ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% 2-mercaptoethanol (Sigma-Aldrich) for western blot.
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... containing 5% 2-Mercaptoethanol (Millipore Sigma; M3148) and boil the samples at 95°C for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5-Fluoro-2’-desoxyuridine (Sigma # F0503), was added to a final concentration of 3 µM on the third day and the medium was exchanged three times per week.