Labshake search
Citations for Millipore Sigma :
5801 - 5850 of 10000+ citations for 6 4 Methyl 1 piperazinyl N 5 methyl 1H pyrazol 3 yl 2 1Z 2 phenylethenyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 1 mg ml-1 of 3–5 kDa fluorescein isothio-cyanate (FITC)-dextran (Sigma-Aldrich, Germany) in phenol-red free DMEM/F12 medium (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Bioengineering 2023Quote: ... Tendons (n = 5/group/time) were then digested with proteinase-K (5 mg/ml) (Sigma) for 18 hours and stored at -20C until further assays could be performed ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2021Quote: ... 8 uL 4-Hydroxy-TEMPO inhibitor (1:200 w/v, Sigma Aldrich, 176141), 8uL TEMED accelerator (10% v/v ...
-
A novel neural stem cell-derived immunocompetent mouse model of glioblastoma for preclinical studiesbioRxiv - Cancer Biology 2020Quote: ... 4-week-old mice were injected intraperitoneally with 1 mg tamoxifen (S5007 Sigma) in 5% ethanol and 95% oil (T5648 Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Dilutions were plated on 1/4-diluted King’s B+++ Agar plates (Sigma-Aldrich) supplemented with 13 mg/L chloramphenicol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were diluted at least 1:4 in 8 M urea (Sigma-Aldrich) dissolved in 100 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... WM983A and WM983B cells were maintained in 4:1 MCDB153 (#M7403, Sigma-Aldrich) and Leibovitz L-15 (#L4386 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were treated with 1 μM 4-OHT (Sigma Aldrich, St. Louis, MO) where indicated.
-
bioRxiv - Cancer Biology 2021Quote: ... The protein was also visualized using 4-Chloro-1-naphthol solution (Sigma Aldrich) which is a substrate for HRP in a reaction that results in a colored precipitate.
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-purkinje cell protein 4 (PCP4, 1:500, Sigma-Aldrich, Cat# HPA005792), rat anti-mCherry (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... 8 uL 4-Hydroxy-TEMPO inhibitor (1:200 w/v, Sigma Aldrich, 176141), 8uL TEMED accelerator (10% v/v ...
-
bioRxiv - Immunology 2019Quote: ... in TBST: anti-FLAG antibody (Sigma F3165; 1:500 overnight at 4°C) and anti -α-tubulin (Covance MMS407R ...
-
bioRxiv - Immunology 2021Quote: ... Mice then received intraperitoneal injection of 1 mL 4% thioglycollate broth (Sigma-Aldrich). Approximately 30 min prior to the end point ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM dithiothreitol (DTT) and 4 μg/mL DNase (Sigma catalog no. DN25). Cells were lysed using a French press and the lysate was centrifuged at 30,000 × g for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antisera were used: rabbit anti-AQ-4 (1:500, #AB3594; Millipore), rabbit anti-YKL-40 (1:300 ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-Purkinje cell protein 4 (PCP4, 1:500, Sigma-Aldrich, Cat# HPA005792), rabbit anti-zinc transporter 3 (ZnT3 ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: ... samples were thawed and centrifuged at 4°C (Sigma Zentrifugen 1-14K, Germany). Cell pellets were resuspended in 1 mL buffer RLT from the RNeasy mini kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-detyrosinated (glutamated) tubulin (1:1500 overnight at 4°C) (#AB3201, Millipore), anti-rabbit- IgG-HRP (1:7500 ...
-
bioRxiv - Cell Biology 2023Quote: T-NMOs were fixed for 1 hour in 4% paraformaldehyde (PFA, Sigma-Aldrich) and NMOs for 1 hour in 2% PFA ...
-
bioRxiv - Neuroscience 2023Quote: ... at room temperature and incubated with Hoechst 1:2000 (Sigma # 23491-45-4) prior to analysis with ImageStream (Flow Cytometry PCMM core facility at BCH and Harvard Medical School).
-
bioRxiv - Immunology 2023Quote: Mice were perfused with 1× PBS followed by 4% paraformaldehyde (PFA; Sigma-Aldrich). L4 DRGs were post-fixed in 4% PFA for 1-2 hours ...
-
bioRxiv - Physiology 2023Quote: ... 500µg of mitochondria were progressively solubilized 1-4% digitonin (Sigma-Aldrich #D141-500MG) dissolved in water ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins in the supernatant were precipitated with 1:4 trichloroacetic acid (Sigma Aldrich). The pellet was washed and disrupted with acetone two times and re-dissolved in 200 mM ammonium bicarbonate with 6 M Urea (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antibodies used for IHC were against ING4 (1:100, BTIM-4, Millipore Sigma), pp65RelA(S276 ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated overnight at 4 C with primary antibody (DM1a, 1:1000, Sigma T6199), washed 3x 5 min in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 uL 4-Hydroxy-TEMPO inhibitor (1:200 w/v, Sigma Aldrich, 176141), 8uL TEMED accelerator (10% v/v ...
-
bioRxiv - Plant Biology 2020Quote: ... and 10 μCi [γ32P]-ATP in reaction buffer (25 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 0.5 mM CaCl2, 2 μM CaM [Sigma-Aldrich], 1 mM DTT) at 30°C for 30 min to perform the vitro kinase assay ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM 2-mercaptoethanol) and concentrated up to 1 nmol/ml (1A260 = 69 pmol) using Amicon Ultra centrifugal filters (Millipore, MWCO 100,000). Further ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μl 1x PBS and 2 μl (1 U) PNGase F (from Elizabethkingia meningoseptica, expressed in E. coli, Sigma Aldrich F8435-50UN) were added to 40 μl of SEC purified YFP-S-RBD (0.24 mg/ml protein concentration) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 volume of AluI-stock was added to 2 volumes of 5 mg ml−1 fluorescein (FITC) labelled 500 kDa dextran fraction (Sigma-Aldrich, FD500S) dissolved in injection buffer (50 mM K-HEPES ...
-
bioRxiv - Cell Biology 2024Quote: ... Worms were synchronized by bleaching and Day 1 adults were plated on NGM plates containing 100 µM 5-Fluoro-2′-deoxyuridine (FuDR) (Sigma Cat. F0503) with or without 4 mM methyl viologen dichloride hydrate (paraquat ...
-
bioRxiv - Molecular Biology 2024Quote: ... Yhb1-TAP and α-tubulin proteins were detected using the polyclonal anti-mouse IgG antibody (ICN Biomedicals) and monoclonal anti-α-tubulin antibody (clone B-5-1-2; Sigma-Aldrich), respectively ...
-
bioRxiv - Pathology 2023Quote: ... the samples were rinsed (1 × 10 sec) and washed with PBS (2 × 5 min) before mounting with glycerol (G5516, Sigma Life Science) and covering with #1.5 coverslips of 22 mm × 22 mm (631-0125 ...
-
bioRxiv - Immunology 2021Quote: The S-variant and RBD coupled bead sets were incubated with sera from immunized mice at 4 dilutions (1:100; 1:1000; 1:10000; 1:100000) for 1 h in 96-well filter plates (MultiScreenHTS; Millipore) and analyzed on a Luminex analyzer (Luminex / R&D Systems ...
-
bioRxiv - Bioengineering 2020Quote: ... The patterned wafer was silanized with trichloro (1H, 1H, 2H, 2H-perfluorooctyl) silane (Sigma Aldrich, USA) to render the surface hydrophobic ...
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 mM EDTA and either re-seeded with split ratios (1:3 to 1:8) onto 6-well plates or cryopreserved using CryoStor CS10 Cryopreservation Reagent (Sigma). iPSC lines were maintained in 5% CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were passaged at a 1:3 to 1:6 ratio every 7 days using cell dissociation solution-non enzymatic (Sigma) and plated in fresh BME matrix droplets.
-
bioRxiv - Biochemistry 2019Quote: ... and 1% NP-40 containing protein phosphatase inhibitor cocktail 1 and 2 (Sigma) and protease inhibitors (Sigma)] ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-activated MAP kinase (diphosphorylated ERK-1&2, 1:20; Sigma-Aldrich), and rabbit anti-Sty (1:50 ...
-
bioRxiv - Plant Biology 2020Quote: ... PGM buffer (6% mannitol, 3% sucrose, M5524 MS salts (Sigma), M7150 vitamins (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... The cell pellets were suspended in 5 ml pure water at 4 ℃ with 0.4 % TritonX-100 (Sigma-Aldrich), 2 μl DNAase Ⅰ(Sigma Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was pipetted from the pellet and 20 mM 5′-(4-Fluorosulfonylbenzoyl)adenosine hydrochloride (FSBA; Sigma Aldrich) was added to the supernatant ...
-
bioRxiv - Genetics 2022Quote: ... ∼100 animals per condition were transferred to 4-5 NGM plates containing 7.5mM t-booh (Luperox TBH70X, Sigma). Worms were scored for survival every 2 hours ...