Labshake search
Citations for Millipore Sigma :
5451 - 5500 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 3 ml LB top-agar (LTA: 20g LB, Sigma; 7.5 g agar, Formedium) or BHI top-agar (BTA ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were then incubated with 3% (v/v) hydrogen peroxide solution (Sigma-Aldrich) for 20 min to block endo-peroxydase activity ...
-
bioRxiv - Biochemistry 2020Quote: ... were resuspended in 25 µL of 3 M HCl in methanol (90964, Sigma), and incubated at 20 °C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... in which 3 mL of 1.3 mg/mL cold collagenase P (Sigma 11213865001) and 0.01 mg/mL DNAse (Sigma D5025 ...
-
bioRxiv - Bioengineering 2021Quote: ... 3) the shielding oil consisted of 0.5% (v/v) Span-80 (Sigma-Aldrich) surfactant dispersed in mineral oil (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.75 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) was added to culture medium for 2 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... TF induction was performed by adding 3 μg/mL of Doxycycline (Sigma, D9891) on day 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 3 days on food containing 400 µM all-trans retinal (Sigma). The following genotypes were assayed ...
-
bioRxiv - Neuroscience 2020Quote: ... washed 3 times in PBS and resuspended in PBS + Protease Inhibitor (PI, Sigma). Worm ‘popcorn’ was prepared by dripping worm solution into liquid nitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The cleaned media were concentrated with a 3 kDa cutoff ultrafilter (Millipore, UFC900324) to 200-300 μl ...
-
bioRxiv - Biophysics 2020Quote: ... passaged every 3-4 days by trypsinization with trypsin-EDTA solution (Sigma-Aldrich) and moved to the corresponding Petri dishes ...
-
bioRxiv - Biophysics 2021Quote: ... concentrated to ~3 mg/ml with a 10 kDa cut-off concentrator (Millipore), flash-frozen by liquid nitrogen and stored at −80 °C until use.
-
bioRxiv - Cancer Biology 2019Quote: ... and further processed by treatment with 3 mg/ml Collagenase type I (Sigma) and 0.1 mg/ml Dispase (Dominique Dutscher SA ...
-
bioRxiv - Cancer Biology 2019Quote: ... slides were incubated with 3% hydrogen peroxide (323381, Sigma-Aldrich, St. Louis, MO) for 30 min and then in 2.5% normal horse serum for 1hr ...
-
bioRxiv - Cell Biology 2021Quote: ... animals were anaesthetized with Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich, Cat#: A5040). At the end of the experimental procedures ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mg/ml N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (Sigma, catalog number 03450) in 50 mM Hepes] followed by 10 min UV-light activation ...
-
bioRxiv - Biochemistry 2020Quote: ... coli ClpAΔC9 fused to the 3’-end of His6SumoFLAG cloned into pET23b (Novagen). ClpA was overexpressed in T7Express (NEB) ...
-
bioRxiv - Bioengineering 2021Quote: ... A standard solution of poly(3-hydroxy-butyrate) (average Mn ~500,000, Sigma Aldrich) was prepared using the same method ...
-
bioRxiv - Bioengineering 2021Quote: ... They were then blocked with 3% bovine serum albumin (A9418-500G, Sigma Aldrich) in PBS for 2 hours at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... SC –leu-trp plates and SC –leu-trp-his + 10mM 3-aminotriazole (Sigma) plates ...
-
bioRxiv - Cell Biology 2021Quote: ... Each sample was then blocked and permeabilized in 3% Bovine Serum Albumin (Sigma) and 0.1% Triton X-100 (American Bioanalytical) ...
-
bioRxiv - Plant Biology 2021Quote: ... Western blotting was performed using anti S-tag (Cat no. 71549-3, Novagen) and anti His-tag antibody to detect protein-protein interaction.
-
bioRxiv - Plant Biology 2020Quote: ... with 3 kDa molecular weight cut off (Amicon® Ultra, Merck Millipore Ltd.) to remove high molecular weight conjugates of IAA ...
-
bioRxiv - Microbiology 2020Quote: ... All primers are listed in Table 3 and were obtained from Sigma-Aldrich. PCR reactions were visualized and analyzed by gel electrophoresis on 1 % (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... and (3) GluA2 (mouse anti-glutamate receptor 2; Millipore; used at 1:2000). Cochlear pieces were incubated in species appropriate secondary antibodies coupled to Alexa Fluors in the red ...
-
bioRxiv - Neuroscience 2020Quote: ... 28 mm clean coverslips were treated with 0.5% APMS-3-aminopropyltrimethoxysilane (APMS) (Sigma) in water for 15-20 min followed by 4-5 washes with distilled water ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were washed with cold PBS with 3 μg.ml-1 digitonin (Sigma Aldrich) and fixed in 4% paraformaldehyde (PFA) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were washed and then blocked with 3% bovine serum albumin (BSA; Millipore) in DPBS for one hour at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... embryos were anesthetized with 500 μM tricaine (Ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich), mounted in 3% methyl-cellulose on a glass slide and imaged on a Nikon SMZ25 stereomicroscope.
-
bioRxiv - Plant Biology 2021Quote: Starting reagents 3-hydroxybenzaldehyde 4 and hydrazine hydrate were purchased from Sigma-Aldrich and phenylacetic acid 1 was purchased from Merck ...
-
bioRxiv - Microbiology 2021Quote: ... Calu-3 cells were preincubated with the indicated amounts of ATN-161 (Sigma) for two hours and infected with SARS-CoV-2 Viral isolate BetaCoV/France/IDF0372/2020 (MOI 0.05 ...
-
bioRxiv - Microbiology 2019Quote: ... for 5 min at 14,000 rpm at 4°C (Sigma 3-KIS centrifuge). Samples were snap-frozen in liquid N2 and delipidated by protein precipitation based on the protocol of Wessel and Flügge (61) ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-PC-3 and GP-9A cells were cultured in RPMI-1640 (Sigma). Capan-2 (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... were treated with 500μM IAA (indole-3-acetic acid dissolved in DMSO; Sigma) to induce degradation of the desired AID-tagged target protein ...
-
bioRxiv - Cell Biology 2020Quote: ... Sodium orthovanadate and Phosphatase Inhibitor Cocktail 3 were all obtained from Sigma-Aldrich. RPMI 1640 ...
-
bioRxiv - Biophysics 2020Quote: ... and 2 mg/ml N-(3-dimethylaminopropyl)-N′-ethylcarbodiimidehydrochloride (EDC, Sigma-Aldrich, 03450) in 50 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) ...
-
bioRxiv - Biophysics 2020Quote: ... 4.5% acetic acid and 2.5% 3-(triethoxysilyl)-propylamine (EMD Millipore Corp., Billerica, MA), rinsed with methanol and water and finally dried under a stream of nitrogen (63) ...
-
bioRxiv - Biophysics 2020Quote: We performed Arp2/3 complex and myosin-II inhibition experiments using ck666 (Sigma) and blebbistatin (Abcam) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with BrdU:BrdC (3:1, final concentration 10 μM; Sigma-Aldrich) for 16 h prior to metaphase preparation as above ...
-
bioRxiv - Cancer Biology 2021Quote: ... noggin and EGF and containing 10 µM nutlin-3 (Sigma #675576-98-4).
-
bioRxiv - Developmental Biology 2022Quote: 3 and 5dpf embryos were fixed and stained using Sudan Black (Sigma-Aldrich) (le Guyader et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 % glucose (FUJIFILM Wako) and 0.1 mg/mL each of adenine (Sigma-Aldrich), uracil (Sigma -Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... Aß 1-42 and also Aß (Pyr) 3-42 were from Sigma-Aldrich.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... We dissolved analytical grade imidacloprid (CAS Number: 138261-41-3, Sigma Aldrich, Sweden) in a solution of 10% raw sugar in 0.01M Phosphate Buffer to achieve logarithmically spaced concentrations of imidacloprid ranging from µg/L to 2 g/L (Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... and solidified with 3 g l-1 Phytagel (Sigma-Aldrich, St. Louis, USA). Plantlets roots were placed on the surface of the medium and the shoots were let extrude the Petri dish through a hole in the lid (Giachero et al ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were rinsed 3 times in PBS and then mounted with Fluoshield (Sigma). Whole brain images were obtained on an Olympus virtual slide microscopy VS120-L100-W with a 10x objective (Olympus Canada Inc. ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-phospho Histone 3 (Ser 10) (Millipore; 1/500; Cat # 06-570), rabbit anti-myelin basic protein (Custom produced (Tingaud-Sequeira Angèle ...