Labshake search
Citations for Millipore Sigma :
5451 - 5500 of 10000+ citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... Differentiated osteoclasts with >3 nuclei were identified as tartrate-resistant acid phosphatase-positive (Leukocyte Acid Phosphatase Assay, Sigma).
-
bioRxiv - Cell Biology 2020Quote: ... followed by treatment with 500 µM auxin (3-Indoleacetic acid; Sigma) for 5-6 hrs.
-
bioRxiv - Molecular Biology 2021Quote: ... 1mg/mL of Indole-3-acetic acid (Sigma, I3750-5G-A) was added ...
-
bioRxiv - Immunology 2019Quote: ... (3-aminobenzoic acid ethyl ester; Sigma Aldrich, St. Louis, MO, USA) before infection ...
-
bioRxiv - Biophysics 2020Quote: ... Membrane strips were blocked with 3% fatty acid-free BSA (Sigma) in 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 500 uM 3-indole acetic acid (IAA) (Sigma-Aldrich I2886).
-
bioRxiv - Plant Biology 2021Quote: ... 10 or 100 nM IAA (Indole-3-acetic acid, Millipore Sigma), 100 nM or 1 µM ACC (1-aminocyclopropanecarboxylic acid ...
-
bioRxiv - Cell Biology 2021Quote: ... strips were blocked with 3% fatty acid-free BSA (Sigma-Aldrich) in PBS buffer containing 0.1% Tween 20 (PBS-T ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 500 µM 3-indoleacetic acid (auxin) (Sigma) in DMSO or mock-treated with DMSO alone ...
-
bioRxiv - Biochemistry 2020Quote: ... 500 μM IAA (indole-3-acetic acid dissolved in DMSO; Sigma) was added to media to induce degradation of the AID-tagged protein ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.05% Tween 20) containing 3% fatty acid-free BSA (Sigma) and gently agitated for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2019Quote: ... embryos were anesthetized with Tricaine (3-amino benzoic acid ethylester; Sigma), 4 mg/ml in E3 media and mounted in 0.5% low-melting agarose (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: Doxycycline (DOX) and auxin (indole-3-acetic acid, IAA) (Sigma-Aldrich) were dissolved in cell culture-grade water and used at 1 μg/mL and 500 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... BxPC-3 cells were supplemented with non-essential amino acids (Sigma). Cultured cells were regularly tested for mycoplasma contamination and used within three months of defrosting.
-
bioRxiv - Molecular Biology 2023Quote: ... Auxin indole-3-acetic acid sodium salt (IAA) (I5148, Sigma-Aldric) was used at 500 nM dissolved in water ...
-
bioRxiv - Cell Biology 2023Quote: ... and replaced with 500 µM Inole-3-acetic acid (IAA, Sigma) for 2h ...
-
bioRxiv - Microbiology 2024Quote: ... 8% polyacrylamide gel containing 0.5% 3- (Acrylamido) phenylboronic acid (Sigma-Aldrich) after resuspending in a 2X RNA Loading Dye (NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... Linoleic Acid (EIC) (Sigma-Aldrich, L1376, CAS number: 60-33-3) were prepared immediately prior to use from DMSO stocks (100 mM) ...
-
bioRxiv - Microbiology 2024Quote: ... Standard solutions were prepared using poly (3-hydroxybutyric acid) (SIGMA Aldrich) and mcl-PHAs from Pseudomonas putida KT2440 ...
-
bioRxiv - Cell Biology 2024Quote: ... were saturated with 3% fatty acid free BSA (Sigma-Aldrich A8806) in PBS-Tween-20 0.1% for 1 h at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... 7 µg ml-1 gentamycin (#G1372, Sigma), 10 µg ml-1 tetracycline (#T3258 ...
-
bioRxiv - Neuroscience 2020Quote: ... pilocarpine (P6503, Sigma-Aldrich, 7 mL.kg−1), cocaine HCl (Cooper France ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse αHA (1:500, HA-7 Sigma), rabbit αPTP7 (1:500) ...
-
bioRxiv - Cell Biology 2022Quote: ... 7-AAD (1μg·mL-1, Millipore Sigma, #A9400) or DAPI (0.5μg·mL-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... 7-AAD (1μg·mL-1, Millipore Sigma, #A9400) or DAPI (0.5μg·mL-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Caspase-7 (1:1000, Sigma-Aldrich, #SAB4503316), LC3 (1:5000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1:500 Cytokeratin-7 (Millipore Sigma MABT1490), and 1:200 E-cadherin (BD Biosciences 610181) ...
-
bioRxiv - Genetics 2024Quote: ... 1:5000 (H3663 HA-7, Sigma-Aldrich), Rabbit anti-Casp ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-7 dpf larvae were anaesthetized in 0.01% chilled tricaine (Sigma-Aldrich) and then fixed overnight at 4°C in 4% paraformaldehyde (Alfa Aesar ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Systems Biology 2021Quote: ... MS-grade acetic acid (64-19-7) was purchased from Sigma Aldrich (St. Louis, MO, USA).
-
Neural interactions in developing rhythmogenic spinal networks: Insights from computational modelingbioRxiv - Neuroscience 2020Quote: ... Locomotion was evoked by bath application of N-Methyl-D-aspartic acid (NMDA, 7 μM, Sigma) and serotonin creatinine sulfate monohydrate (5-HT ...
-
bioRxiv - Bioengineering 2023Quote: ... Hyaluronic acid (HA) sodium salt extracted from rooster comb (#9067-32-7) was obtained from Sigma, and rat tail collagen Type I (#354249 ...
-
bioRxiv - Immunology 2024Quote: ... 10 mM of DL-malic acid (CAS 6915-15-7, Sigma-Aldrich, St. Louis, MO, USA), 20 mM of MES hydrate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pregnant females were injected intraperitoneally at E12.5 with 75 μg/g 4-hydroxytamoxifen (4-OHT; Sigma-Aldrich #H6278) dissolved in corn oil ...
-
bioRxiv - Neuroscience 2021Quote: ... The experimental mice were injected intraperitoneally with 4-Hydroxytamoxifen (4-OHT) (Sigma Aldrich; Cat.#:H6278-50mg; 75mg/kg) once per day during 4 consecutive days ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10 mL of Working Hanks 4 (WH4; 1X HBSS/4 g/L total glucose/1X antibiotic-antimycotic (Sigma)) was added ...
-
bioRxiv - Bioengineering 2022Quote: ... The PEG pre-polymer phase comprised 27.5% w/v 5kDa 4-arm PEG acrylate (Advanced BioChemicals) with 4% w/v lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, Sigma) in phosphate buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2022Quote: U2OS cells were grown on 4 well glass slides (Millicell EZ SLIDE 4 well glass, Millipore Sigma PEZGS0416). After washing three times in 1× PBS (pH 7.4) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pregnant females were injected intraperitoneally (i.p.) with 10 mg/kg 4-hydroxytamoxifen (4-OHT, Millipore-Sigma cat #H6278) dissolved in corn oil (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pregnant females were injected intraperitoneally (i.p.) with 10 mg/kg 4-hydroxytamoxifen (4-OHT, Millipore-Sigma cat #H6278) dissolved in corn oil (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... in addition to the corresponding drug treatment: either 4-hydroxytamoxifen (4-OHT; Sigma Aldrich; stock concentration: 13 mM) or its vehicle ...
-
bioRxiv - Physiology 2022Quote: ... The soluble material was incubated for 4 hours at 4°C with anti-Flag M2 magnetic beads (Sigma). Beads was washed with buffer containing 20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... The pTriEx-4 Ek/LIC hTG4 vector was constructed using pTriEx™-4 Ek/LIC Vector Kit (Novagen) based on the manufacturer instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... Setd2flox/flox MEFs expressing ER-Cre were treated with 3μM (Z)-4-hydroxytamoxifen (4-OHT, Millipore Sigma, H7904) or vehicle (Ethanol ...
-
bioRxiv - Bioengineering 2024Quote: ... 0.5 mM 4-Methylumbelliferone (4-MU, Selleckchem, in 0.1% v/v DMSO) and 0.1 mM Glycyrrhizin (Sigma-Aldrich) added to the culture media for 3 days (0.1% v/v DMSO and DMEM were used as a controls) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4% formaldehyde solution in 0.1 M PBS at around 4°C (Sigma Aldrich Inc., St. Louis, MO, USA) for cryoprotection for about 7-14 days ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were then exchanged into the NMR buffer using Amicon Ultra-4 centrifugal concentrators (4 mL; Millipore Sigma) with a 3-kDa molecular cutoff to a final volume of ∼250 μL ...