Labshake search
Citations for Millipore Sigma :
501 - 550 of 4702 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The plates were loaded with oligomycin (Sigma-Aldrich, O4876), carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP ...
-
bioRxiv - Plant Biology 2021Quote: Root gravitropic response of 50 five-days old seedlings was measured by ImageJ software after transferring seedlings to BM plates (no brefeldin A, BFA) or agar plates containing 10 μM BFA (Sigma catalogue no: B7651) and rotating the plates vertically by 135° for 24h (Richter et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Of this 200 μL and left to form a biofilm in 48 wells plates (Corning® Costar® TC-Treated Multiple Well Plates from Sigma-Aldrich) or chamber slides (Lab-Tek® Chamber SlideTM System ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR conditions were set up to amplify only the short 670 bp product using REDExtract-N-Amp PCR ReadyMix (Sigma). PCR conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Millipore-Sigma) as described previously (1 ...
-
bioRxiv - Neuroscience 2022Quote: Genotyping for the R1.40 transgene locus was done with the recommended PCR primers using the PCR Ready Mix kit (E3004; Sigma-Aldrich). The sequences of the genotyping primers were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... 1.3×106 copies of the PCR product from the mixture above were added into the second round PCR (KOD Hot Start DNA Polymerase, Novagen) to add the adapter for sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... amplified by PCR with Phusion U Hot Start PCR MasterMix (Thermo-Fischer Scientific) in presence of 0.5 mM betaine (Sigma-Aldrich) using universal bacterial primers (27F 5’ AGAGTTTGATCCTGGCTCAG and 1492R 5’ GGTTACCTTGTTACGACTT ...
-
bioRxiv - Genetics 2021Quote: ... Purification of genomic Polymerase Chain Reaction (PCR) amplified DNA was performed with the GenElute PCR Clean-Up kit (Sigma-Aldrich) or the GeneJET PCR Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Gene expression was measured by quantitative RT-PCR and normalized to β-actin8,48 The SYBR Green quantitative RT-PCR kit (Sigma) was used with the following primers ...
-
bioRxiv - Genomics 2020Quote: ... The painting probes were generated from the DOP-PCR amplified samples by a secondary DOP-PCR incorporation of biotin-dUTP and digoxigenin-dUTP (Sigma) [25] ...
-
bioRxiv - Neuroscience 2023Quote: ... The gDNA samples were then amplified by polymerase chain reaction (PCR) using ReadyMix(TM) Taq PCR Reaction Mix (P4600,Sigma) containing 12.5μL Reaction Mix (P4600 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 18bp of the reverse complement of the beginning of the DNA tag sequences was added to the 5’ of the reverse primer so that the CRM can be combined with the DNA tag in equal amount using overlap PCR (Xiong et al., 2006) using Expand High Fidelity PLUS PCR (Sigma). The resulting fragment was run on 2% agarose 1x TAE gel ...
-
bioRxiv - Microbiology 2020Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified 1,297 RT-PCR products were digested with MluI (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... The PCR products were cloned into pET21a (Novagen) using InFusion cloning technology ...
-
bioRxiv - Genomics 2020Quote: ... 1M betaine (PCR Reagent grade, Sigma-Aldrich, USA) and 0.667μM of each random primer (5’GTGAGTGATGGTTGAGGTAGTGTGGAGNNNNNTTT 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 0.5μM PCR primers (Sigma-Aldrich; S4 Table) in a Real-Time PCR Detection System CFX96 (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... and Expand high-fidelity PCR system (Sigma-Aldrich). RT-PCR products were purified on 0.7% agarose gel and subjected to Sanger sequencing (ACGT) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer pairs for PCR were from Sigma (eGFP) and Invitrogen (GAPDH) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of BioStabII PCR Enhancer (Sigma). For each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subsequent PCR was performed with primers (Sigma-Aldrich) based on the Icelandic rock ptarmigan genome and Taq DNA polymerase (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were subjected to 0.7% agarose gel analysis and the gel-purified PCR fragments were subjected to sanger sequencing (ACGT) ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR system (Sigma Aldrich). Amplified DNA products were separated on a 0.7% agarose gel ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were first cloned in pET22b (Novagen; containing the N-terminal pelB sequence ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification with PCR Cleanup kit (Sigma-Aldrich), nucleic acids were eluted in 100 μL of elution buffer (5 mM Tris-HCl pH 8.5 ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were separated on a 0.7% agarose gel ...
-
Anatomical meniscus construct with zone specific biochemical composition and structural organizationbioRxiv - Bioengineering 2019Quote: ... SybrGreen Quantitative RT-PCR kit (Sigma Aldrich, Germany) was used with Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... using Expand Long Template PCR System (Sigma Aldrich). PCR primers were designed using the MEIS1 promoter as a viewpoint and included Truseq adapters ...
-
A pancreas specific Ptf1a-driven Cre mouse line causes paternally transmitted germline recombinationbioRxiv - Genetics 2020Quote: ... supplemented with 10ul PCR grade Proteinase K (Sigma) at 55°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Nested PCR primers were ordered from Sigma-Aldrich’s custom oligo service ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). Amplified DNA products ...
-
bioRxiv - Microbiology 2022Quote: The KAPA Taq PCR Kit (Sigma-Aldrich KR0352_S) was used to amplify the reads from a cDNA mixture of uninfected samples and 1 ...
-
bioRxiv - Microbiology 2024Quote: ... PCR II products were then purified by Millipore MultiScreen PCR 96 plate according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... purified (GenElute PCR Clean-up kit, Sigma Aldrich) and quantified using a Qubit Fluorometer (Life Technologies ...
-
bioRxiv - Genetics 2024Quote: ... a 10μL PCR re-action mix (5.3uL Sigma Water ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR products were cloned into pET28 (Novagen) or pRSETA (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... or Expand Long Template PCR system (Roche/Sigma) and the oligonucleotides ...
-
bioRxiv - Microbiology 2023Quote: ... PCR product was cloned into vector pET28a (Novagen) and the obtained construct was used to transform E ...
-
bioRxiv - Immunology 2023Quote: ... PCR II products were then purified by Millipore MultiScreen PCR 96 plate according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich) was used to assure that all cell lines were mycoplasma-free ...
-
bioRxiv - Biophysics 2020Quote: ... into a well of the well plate reader (Tecan Infinite M1000 PRO; Well plate: corning black polystyrene 384 well microplate with a flat bottom, Sigma-Aldrich, catalogue number: CLS3821). The fluorescence was read out from the bottom of the wells ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Millipore-Sigma) as described previously (1 ...
-
bioRxiv - Genetics 2020Quote: ... and 1 μl of 1:10 diluted DNA was used as a template for PCR using the REDTaq ReadyMix PCR Reaction Mix (Sigma-Aldrich). The PCR conditions were as follows ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-CTGGGAGTATACTTGTAGTC-3) were run in multiplex with PCR reaction mixtures consisting of 10 μl redtaq (REDTaq ReadyMix PCR Reaction Mix, Sigma-Aldrich), 2 μl DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... the Msm guaB1 gene was amplified by PCR by primer pair 17/18 and inserted into the PCR-linearized pTriex-4 vector (Novagen, USA) with primers 15/16 by the In-Fusion approach ...
-
bioRxiv - Immunology 2021Quote: ... we extracted genomic DNA from mouse tails and performed PCR with REDExtract-N-Amp™ Tissue PCR Kit following the manufacturer’s instructions (Sigma-Aldrich) and analyzed samples on agarose gel ...
-
bioRxiv - Microbiology 2020Quote: ... the junctions of targeted integration were amplified by (semi-)nested PCR using 300 ng genomic DNA containing 1x PCR buffer (Sigma Aldrich), 1.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2019Quote: ... The DNA substrate was generated by PCR and the products were purified using a GenElute PCR Clean-up kit (Sigma-Aldrich). If required ...
-
bioRxiv - Genomics 2021Quote: ... The number of necessary library PCR amplification cycles was determined by qRT-PCR using SYBR Green 10x in DMSO (Sigma-Aldrich) and NEBNext Master Mix 2x (New England BioLabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... The DNA substrate was generated by PCR and the products were purified using a GenElute PCR Clean-up kit (Sigma-Aldrich). If required ...