Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... and phosphatase inhibitor cocktails 2&3 (Sigma # 5726 & P0044). Cells were lysed on ice for 15 min and then centrifuged at 13,000 g for 15 min at 4 °C to remove insoluble debris ...
-
bioRxiv - Immunology 2021Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich). Lysates were cleared by 10 min centrifugation at 15000xg and incubated with GFP-trap beads (Chromotek) ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting Vcan exon 2 or exon 3 (Sigma-Aldrich, target IDs MM0000080027 and MM0000080028 ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitors (Sigma phosphatase inhibitor 2 and 3), then sonicated using a Fisher sonicator at 12% amplitude for total of 20 seconds ...
-
bioRxiv - Neuroscience 2021Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich). Cell lysates were cleared by centrifugation at 4 °C for 15 min at 13,000 rpm ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% 2-hydroxyethyl agarose (agarose, A4018; Sigma-Aldrich, Australia) was prepared as stock solution ...
-
bioRxiv - Immunology 2020Quote: ... and anti-phosphatase cocktails 2 and 3 (Sigma-Aldrich). Protein concentrations were quantitated with a BCA assay (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich). For IPs ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3 (P5726 and P0044, Sigma), 0.1% NP-40 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma Aldrich). Equal amount of protein lysates was incubated with 20ug of GST-RBD beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... and BDM (2, 3-butandion-monoxim, 10 mM, Sigma) were added to the perfusion solution ...
-
bioRxiv - Genomics 2023Quote: ... 3 mM Mg(Ac)2 (Sigma-Aldrich, M5661-50G), 0.1 mM EDTA (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich). After sonication (0.5 s pulse at 20% amplitude ...
-
bioRxiv - Physiology 2024Quote: ... and 3) 80 mM 2-deoxyglucose (Sigma Aldrich D8375). Basal ECAR was measured as post-glucose ECAR minus post 2-DG ECAR ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 mM potassium hexacyanoferrate(III) (C6FeK3N6+3; Sigma Aldrich), 1 mg/mL X-Gluc (5-bromo-4-chloro-3-indolyl β-D-glucuronic cyclohexylammonium salt ...
-
bioRxiv - Cancer Biology 2023Quote: ... phosphatase inhibitor 2 and 3 (Sigma Aldrich; P5726and P0044). Samples were standardized for protein concentration using the Pierce BCA protein assay (VWR 23227) ...
-
bioRxiv - Molecular Biology 2023Quote: ... injected with 2 ml of 3% thioglycollate (Sigma-Aldrich), to obtain intraperitoneal macrophages (macrophage purity > 95% ...
-
bioRxiv - Immunology 2020Quote: ... F(ab’)2 fragment (1:1000, SAB4600082 Sigma-Aldrich) for 45 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma H0887).
-
bioRxiv - Physiology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylidole, 1 μg/mL, Sigma-Aldrich, Israel) was added followed by fluorshield (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Sporozoites were fixed with 4% formalin solution (SIGMA, Cat# HT50-1-2) for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and DAPI (4’,6-diamino-2-phenylindole) (D9542; Sigma; 1 μg/mL). Additionally ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma H0887). These cells were chosen as an experimental system as previously described (Massacci et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... selected for 2-3 weeks with 1 µg/ml of puromycin (Sigma- Aldrich), and surviving cells were fixed with methanol and stained with Giemsa (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1% phosphatase inhibitor cocktails 2 and 3 (P5726 and P0044, Sigma-Aldrich) added fresh] or RIPA buffer [25 mM Tris pH 7.5 ...
-
bioRxiv - Neuroscience 2020Quote: ... and (3) GluA2 (mouse anti-glutamate receptor 2; Millipore; used at 1:2000). Cochlear pieces were incubated in species appropriate secondary antibodies coupled to Alexa Fluors in the red ...
-
bioRxiv - Microbiology 2019Quote: ... 1/200 (v/v) each phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich), and 1/100 (v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... 2.5mM Na3VO4 and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma) and set on ice for 10 minutes prior to sonication ...
-
bioRxiv - Molecular Biology 2023Quote: ... at a ratio of 3:2:1 in HEK 293T cells (Sigma Aldrich) using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 to 3 million cells were cross-linked using 1% formaldehyde (Sigma, F8775) for 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 from Sigma Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Developmental Biology 2020Quote: ... newly hatched or decapsulated tadpoles were immersed in a 500 μM solution of the fluorophore 4-(4-diethylaminostyryl)-1-methylpyridinium iodide (4-di-2-ASP, Sigma D-3418, sigmaaldrich.com) for five minutes at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Biochemistry 2022Quote: ... they were cultivated 72 hours in the presence of 2 μM DL-threo-1-phenyl-2-palmitoylamino-3-morpholino-1-propanol (PPMP) (Sigma-Aldrich) to inhibit the synthesis of glucosylceramide-based GSLs 75 and incubated with fluorescent SaroL-1 as previously described ...
-
bioRxiv - Neuroscience 2020Quote: ... 4–5-week-old mice were anesthetized by intraperitoneal injection of 2% 2,2,2-tribromoethanol (Sigma), dissolved in saline ...
-
bioRxiv - Neuroscience 2023Quote: ... (D-Ala(2)-mephe(4)-gly-ol(5))enkephalin (DAMGO, Sigma-Aldrich, Cat. No. E7384) at 50 µM or lipopolysaccharide (LPS ...
-
bioRxiv - Cell Biology 2019Quote: ... (TDP43: 5’-gcaaagccaagaugagccu-3’ and EGFP control: 5’-gcaccaucuucuucaagga-3’; Sigma). Silenced cells were collected by trypsinization ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Plant Biology 2024Quote: ... meliloti 1021 (pXLGD4) strain were stained using 5-bromo-6-chloro-3-indolyl-β-d-galactopyranoside (Magenta-Gal, Sigma-Aldrich), according to the protocol described previously by Jarzyniak et al ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Cancer Biology 2019Quote: ... injected daily with 5 mg/kg body weight ethyl-2-[6-(4-chlorophenoxy)hexyl]-oxirane-2-carboxylate (etomoxir) (Sigma-Aldrich, US), dissolved in 5% (2-Hydroxypropyl)-β-cyclodextrin solution from day 8 following tumor transplantation (LLC-Eto) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Bioengineering 2022Quote: 4-Nitrophenyl β-D-glucuronide (4-NPG, CAS no. 10344-94-2) (Sigma-aldrich) was prepared in 50 mM sodium phosphate buffer (Na-PB ...
-
bioRxiv - Biochemistry 2023Quote: ... and 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium (DMTMM) chloride (Sigma-Aldrich) in buffer C for 1 h at 37°C and 500 rpm using a ThermoMixer (Eppendorf) ...