Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 7 Chloro 3 methyl 3H 1 2 3 triazolo 4 5 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... concentrated 10 times using Amicon Ultra-4 Ultracel-3 3 kDa centrifugal filter units (Millipore, UFC800308). Aliquots of concentrated medium and flowthrough medium were frozen at −80°C.
-
bioRxiv - Pathology 2024Quote: ... concentrated 10 times using Amicon Ultra-4 Ultracel-3 3 kDa centrifugal filter units (Millipore, UFC800308). Aliquots of concentrated media and flowthrough media were frozen at −80°C.
-
bioRxiv - Bioengineering 2022Quote: ... and 1% w/v of 2-Hydroxy-4’-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure D-2959) photoinitiator (Sigma-Aldrich) in phosphate buffered saline (PBS ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimidehydrochloride (EDC) were procured from Sigma Aldrich, USA.
-
bioRxiv - Physiology 2019Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma-Aldrich, No. E7750) and an amide ...
-
bioRxiv - Plant Biology 2022Quote: ... and crosslinked using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma). Biotin-labelled probes were hybridized with sRNAs on the nylon membrane and stabilized streptavidin-horseradish peroxidase was used to detect the biotin signal.
-
bioRxiv - Synthetic Biology 2023Quote: ... activated with 250mM 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma)/ N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate (CHAPS) (C3023; Sigma Aldrich), and sodium dodecyl sulfate (SDS ...
-
bioRxiv - Cancer Biology 2023Quote: ... staining solution (0.3 mg/ml of 5-bromo4-chloro-3indolyl β-D-galactoside, X-Gal Fermentas R0401, 40 mM citric acid, Sigma C-0759 ...
-
bioRxiv - Plant Biology 2020Quote: ... samples were resuspended in Urea 7 M and Thiourea 2 M buffer and desalted on Amicon Ultra-0.5 3 kDa centrifugal filters (Merck Millipore, Germany). Filters were filled to maximum capacity with buffers and centrifuged at 15,000 g for 10 min at 20°C ...
-
bioRxiv - Genomics 2019Quote: ... and 3 × 10−5 mM hydrocortisone (Sigma H0888) in 6 well plates (Figure 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 µM 9-Amino-6-Chloro-2-Methoxyacridine (ACMA, Sigma-Aldrich) to establish a K+ gradient ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Genetics 2021Quote: ... was propagated and maintained by transferring shoot segments of 3-4 cm with 1-2 young leaves to fresh one-half Murashige and Skoog (Beijing, China, Sigma-Aldrich). Plantlets were grown at 23 ℃ under a 16 h light/8 h dark cycle with a light intensity of illumination of 5000 lux provided by cool white fluorescent lamp tubes ...
-
bioRxiv - Microbiology 2022Quote: ... 3-(N-Morpholino)propanesulfonic acid (MOPS) or 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) buffer (all purchased from Sigma-Aldrich, USA). Macrocolonies were excised and resuspended in 2 mL of sterile 1X PBS ...
-
bioRxiv - Cell Biology 2021Quote: Perfluorononanoic acid (PFNA, 97%), 3-Isobutyl-1-methylxanthine (IBMX, ≥ 99%) and 2’,7’-dichlorofluorescin diacetate (DCFH-DA, ≥ 97%) were obtained from Sigma-Aldrich (St. Louis, MO, USA). JC-1 Mitochondrial Membrane Potential Detection Kit and MitoView™ Green were purchased from Biotium (Hayward ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 7-deaza-2’-deoxy-guanosine-5’-triphosphate (7-Deaza-dGTP)(10988537001, Sigma-Aldrich) to aid in amplifying GC rich regions ...
-
bioRxiv - Biochemistry 2022Quote: ... D-glucose N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Molecular Biology 2024Quote: ... were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251) (Sigma-Aldrich) in the presence of 1 µg of rFhENO or 1% BSA as negative control in a test volume of 100 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... Washed pellets were resuspended in a 7:3 ratio of chemotaxis buffer (see above) and Optiprep (60% iodixanol in sterile ddH2O w/v, Sigma-Aldrich, D-1556), resulting in a net dilution to 18% iodixanol w/v ...
-
bioRxiv - Neuroscience 2019Quote: ... dissolved in 2-methyl-2-butanol (Sigma Aldrich) 2.5% v/v)] ...
-
bioRxiv - Neuroscience 2024Quote: ... 2-methyl-2-thiazoline (2MT; M83406, Sigma Aldrich) presented in a Plexiglas arena (43 × 27 × 19 cm ...
-
bioRxiv - Developmental Biology 2022Quote: 2’,7’-Dichlorodihydrofluorescein diacetate (DCFH-DA) (5 mg/mL, Sigma) was used to label the zebrafish intestines at 7 dpf ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated with 5 μM 2′,7′-dichlorofluorescin-diacetate (Sigma) for 20 min at 37°C ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2019Quote: ... The resulting pellets were further extracted by sonication in 3X volumes of SDS lysis buffer (50 mM Tris-HCl pH 7.4, 2% SDS, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]). Samples were centrifuged at 21,000g for 30 min at 25°C to obtain the Triton-insoluble (SDS-soluble ...
-
bioRxiv - Bioengineering 2023Quote: ... gels were washed 3 times x 5 minutes with a 3% Bovine Serum Albumin (BSA, Sigma) blocking solution in PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 nM ALK2/3 inhibitor LDN193189 (Miltenyi Biotech, 130-106-540) and 10 uM ALK4/5/7 inhibitor SB431542 (Millipore, 616464). Medium was replaced on days 1 and 2.
-
bioRxiv - Molecular Biology 2024Quote: ... containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’) targeting exon 7 of ERBB2 (cloned by Twin Helix) and selected with puromycin (Sigma-Aldrich) for 4 days (1 μg/ml puromycin for 72 hours ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...
-
bioRxiv - Neuroscience 2019Quote: ... KO2 along with Cas9 donor plasmid were used as template DNA and amplified with F 5’-GAAGAAGAATGGCCTGTTCG-3’ and R 5’-GCCTTATCCAGTTCGCTCAG-3’ with KOD Xtreme (Novagen, #71975). Cycling conditions were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial DNA was used to amplify the entire 16S region by PCR [5′-AGAGTTTGATCCTGGCTCAG-3′ (forward) and 5′-AAGGAGGTGATCCAGCCGCA-3′ (reverse)] using Expand High-Fidelity Polymerase (Sigma-Aldrich). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen) ...
-
bioRxiv - Bioengineering 2022Quote: ... HA-TBA was dissolved in anhydrous DMSO (2 wt%) with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Physiology 2020Quote: ... 3-isobutyl-1-methylxanthine (Sigma); Glyh-101 (a gift from the Cystic Fibrosis Foundation Therapeutics and Robert Bridges ...
-
bioRxiv - Physiology 2019Quote: ... 3-isobutyl-1-methylxanthine (Sigma); Glyh-101 (a gift from the Cystic Fibrosis Foundation Therapeutics and Robert Bridges ...
-
bioRxiv - Pathology 2021Quote: ... 1% phosphatase inhibitor 3 (Sigma), and 1X HALT protease inhibitor cocktail (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... Odors (Sigma, Tables 1-3) were injected into the steady air stream by opening valves to one of two odor reservoirs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were passaged at a 1:3 to 1:6 ratio every 7 days using cell dissociation solution-non enzymatic (Sigma) and plated in fresh BME matrix droplets.